Incidental Mutation 'R0547:Flnb'
ID44927
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0547 (G1)
Quality Score164
Status Validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 7912943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably null
Transcript: ENSMUST00000052678
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.6224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGATGCCACACGGAATGTTAGAAG -3'
(R):5'- ACAGGATGCAGACTCACCTCTTGG -3'

Sequencing Primer
(F):5'- TTTACTGAGGCCACAGATGC -3'
(R):5'- TGTCCACTGTGAAGGACTGC -3'
Posted On2013-06-11