Incidental Mutation 'R0547:Olfr734'
ID44928
Institutional Source Beutler Lab
Gene Symbol Olfr734
Ensembl Gene ENSMUSG00000045306
Gene Nameolfactory receptor 734
SynonymsMOR242-1, GA_x6K02T2PMLR-6013665-6012724
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50316506-50326761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50320118 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 239 (I239K)
Ref Sequence ENSEMBL: ENSMUSP00000150732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050928] [ENSMUST00000217152]
Predicted Effect probably benign
Transcript: ENSMUST00000050928
AA Change: I239K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000057376
Gene: ENSMUSG00000045306
AA Change: I239K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-39 PFAM
Pfam:7tm_1 41 302 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216732
Predicted Effect probably benign
Transcript: ENSMUST00000217152
AA Change: I239K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Olfr734
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr734 APN 14 50320275 missense probably damaging 0.96
IGL01285:Olfr734 APN 14 50320256 missense possibly damaging 0.88
IGL02106:Olfr734 APN 14 50320160 missense probably damaging 1.00
IGL02313:Olfr734 APN 14 50320016 missense probably damaging 0.99
IGL03125:Olfr734 APN 14 50320692 missense probably benign 0.01
R0276:Olfr734 UTSW 14 50320179 missense probably benign 0.23
R0567:Olfr734 UTSW 14 50320658 missense probably damaging 0.99
R0927:Olfr734 UTSW 14 50320729 nonsense probably null
R1506:Olfr734 UTSW 14 50320484 missense probably benign 0.00
R4032:Olfr734 UTSW 14 50320310 missense possibly damaging 0.91
R5179:Olfr734 UTSW 14 50320536 nonsense probably null
R5401:Olfr734 UTSW 14 50320109 missense probably damaging 1.00
R6240:Olfr734 UTSW 14 50320586 missense probably benign 0.00
X0064:Olfr734 UTSW 14 50320054 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCTGCTTGACATTTCACAGTG -3'
(R):5'- CGGATTGCTTGTGCCAATACTTTCC -3'

Sequencing Primer
(F):5'- tgactcacaactctctattaactcc -3'
(R):5'- GCCAATACTTTCCTGGAAGAAATGG -3'
Posted On2013-06-11