Mutagenetix > Incidental Mutation

Incidental Mutation 'R5830:Apobec3'

449285

Institutional Source

Beutler Lab

Gene Symbol

Apobec3

Ensembl Gene

ENSMUSG00000009585

Gene Name

apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3

Synonyms

Rfv-3, Gm20117, Rfv3, CEM15

MMRRC Submission

043219-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79775860-79800107 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79783268 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 115 (N115I)

Ref Sequence

ENSEMBL: ENSMUSP00000134938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023054] [ENSMUST00000109620] [ENSMUST00000165537] [ENSMUST00000175714] [ENSMUST00000175752] [ENSMUST00000176325] [ENSMUST00000177350] [ENSMUST00000230135] [ENSMUST00000177483] [ENSMUST00000177006] [ENSMUST00000176868] [ENSMUST00000230741] [ENSMUST00000177098] [ENSMUST00000176904]

AlphaFold

Q99J72

Predicted Effect

probably benign
Transcript: ENSMUST00000023054

SMART Domains

Protein: ENSMUSP00000023054
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	6.5e-22	PFAM
Pfam:APOBEC_C	37	91	2.8e-23	PFAM
Pfam:APOBEC_N	106	276	4.4e-28	PFAM
Pfam:APOBEC_C	215	268	1.5e-21	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000109620
AA Change: N214I

SMART Domains

Protein: ENSMUSP00000105249
Gene: ENSMUSG00000009585
AA Change: N214I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	21	198	6.5e-37	PFAM
Pfam:APOBEC_C	136	190	4.9e-23	PFAM
low complexity region	203	213	N/A	INTRINSIC
Pfam:APOBEC_N	238	408	1.1e-27	PFAM
Pfam:APOBEC_C	347	400	2.5e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165537

SMART Domains

Protein: ENSMUSP00000132391
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	21	198	5.4e-37	PFAM
Pfam:APOBEC_C	136	190	4.3e-23	PFAM
Pfam:APOBEC_N	205	375	9e-28	PFAM
Pfam:APOBEC_C	314	367	2.3e-21	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000175714
AA Change: N225I

SMART Domains

Protein: ENSMUSP00000135027
Gene: ENSMUSG00000009585
AA Change: N225I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	37	206	1.1e-57	PFAM
Pfam:APOBEC_C	148	199	2e-22	PFAM
low complexity region	214	224	N/A	INTRINSIC
Pfam:APOBEC_N	253	416	7.6e-33	PFAM
Pfam:APOBEC_C	359	409	3.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175752

SMART Domains

Protein: ENSMUSP00000135358
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	32	209	7.9e-37	PFAM
Pfam:APOBEC_C	147	201	6.3e-23	PFAM
Pfam:APOBEC_N	216	386	1.3e-27	PFAM
Pfam:APOBEC_C	325	378	3.3e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175801

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175849

Predicted Effect

probably benign
Transcript: ENSMUST00000176325
AA Change: N225I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000134838
Gene: ENSMUSG00000009585
AA Change: N225I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	32	209	9e-37	PFAM
Pfam:APOBEC_C	147	201	6.8e-23	PFAM
low complexity region	214	224	N/A	INTRINSIC
Pfam:APOBEC_N	249	419	1.5e-27	PFAM
Pfam:APOBEC_C	358	411	3.6e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177350
AA Change: N115I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134938
Gene: ENSMUSG00000009585
AA Change: N115I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	1.6e-22	PFAM
Pfam:APOBEC_C	37	91	9.8e-24	PFAM
low complexity region	104	114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176644

Predicted Effect

probably benign
Transcript: ENSMUST00000230135

Predicted Effect

probably benign
Transcript: ENSMUST00000177483

SMART Domains

Protein: ENSMUSP00000135011
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	1.3e-22	PFAM
Pfam:APOBEC_C	37	91	8.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177006

Predicted Effect

probably benign
Transcript: ENSMUST00000176868

Predicted Effect

probably benign
Transcript: ENSMUST00000230741

Predicted Effect

probably benign
Transcript: ENSMUST00000177098

SMART Domains

Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	31	209	6.8e-37	PFAM
Pfam:APOBEC_C	147	201	6e-23	PFAM
Pfam:APOBEC_N	216	386	1.2e-27	PFAM
Pfam:APOBEC_C	325	378	3.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176904

SMART Domains

Protein: ENSMUSP00000135502
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	84	7.4e-21	PFAM
Pfam:APOBEC_C	37	85	2.7e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230410

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.1%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele display more rapid and extensive spread of viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl14ep	T	C	2: 106,799,539 (GRCm39)	S101G	possibly damaging	Het
Atp6v0a2	C	T	5: 124,779,485 (GRCm39)	T200I	probably damaging	Het
Ccdc40	C	A	11: 119,133,572 (GRCm39)	H571N	probably benign	Het
Cdc42bpb	G	A	12: 111,312,016 (GRCm39)	R99*	probably null	Het
Cdyl2	A	G	8: 117,321,823 (GRCm39)	Y235H	probably benign	Het
Chmp2a	T	C	7: 12,766,039 (GRCm39)	D161G	probably damaging	Het
Ep400	A	T	5: 110,831,862 (GRCm39)	W2091R	unknown	Het
Epha8	G	A	4: 136,663,701 (GRCm39)	Q452*	probably null	Het
Fbn2	A	G	18: 58,247,541 (GRCm39)	F451S	probably benign	Het
Fndc1	C	A	17: 8,007,918 (GRCm39)	R72L	possibly damaging	Het
Gfpt2	A	G	11: 49,699,888 (GRCm39)	E81G	probably benign	Het
Gpr155	A	G	2: 73,200,433 (GRCm39)	V358A	possibly damaging	Het
Hnrnpk	A	T	13: 58,545,548 (GRCm39)	Y92*	probably null	Het
Il34	A	G	8: 111,475,323 (GRCm39)	V71A	probably damaging	Het
Inpp5e	A	G	2: 26,290,427 (GRCm39)	F416L	probably damaging	Het
Iqgap2	C	T	13: 95,811,880 (GRCm39)	R707H	probably damaging	Het
Kdsr	A	G	1: 106,675,262 (GRCm39)	S125P	possibly damaging	Het
Ldb1	T	A	19: 46,022,557 (GRCm39)	M307L	probably benign	Het
Lrr1	T	A	12: 69,225,445 (GRCm39)	S374T	possibly damaging	Het
Mtmr2	A	G	9: 13,713,274 (GRCm39)	I412V	probably benign	Het
Ncor1	T	C	11: 62,235,589 (GRCm39)	I298V	possibly damaging	Het
Ndst1	A	G	18: 60,836,910 (GRCm39)	F384L	probably damaging	Het
Nlrc5	A	G	8: 95,199,542 (GRCm39)	E51G	probably damaging	Het
Obox6	G	A	7: 15,568,382 (GRCm39)	H165Y	possibly damaging	Het
Or5k17	T	A	16: 58,746,457 (GRCm39)	H159L	possibly damaging	Het
Pde8b	A	T	13: 95,178,398 (GRCm39)	F582Y	probably benign	Het
Pik3r4	C	A	9: 105,522,023 (GRCm39)	Y196*	probably null	Het
Pink1	A	T	4: 138,043,325 (GRCm39)	M1K	probably null	Het
Scn7a	A	T	2: 66,544,395 (GRCm39)	Y365*	probably null	Het
Sec16a	A	T	2: 26,330,853 (GRCm39)	D387E	probably benign	Het
Sel1l	A	T	12: 91,799,945 (GRCm39)	F127Y	probably damaging	Het
Syt7	T	A	19: 10,399,151 (GRCm39)	N82K	probably damaging	Het
Zfp358	G	T	8: 3,545,846 (GRCm39)	V143L	probably benign	Het
Zkscan2	T	C	7: 123,079,323 (GRCm39)	N878S	possibly damaging	Het

Other mutations in Apobec3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02529:Apobec3	APN	15	79,781,888 (GRCm39)	unclassified	probably benign
R1863:Apobec3	UTSW	15	79,782,068 (GRCm39)	missense	possibly damaging	0.58
R1885:Apobec3	UTSW	15	79,781,906 (GRCm39)	missense	probably damaging	1.00
R3815:Apobec3	UTSW	15	79,783,301 (GRCm39)	missense	possibly damaging	0.95
R4175:Apobec3	UTSW	15	79,779,653 (GRCm39)	missense	probably damaging	1.00
R4677:Apobec3	UTSW	15	79,779,713 (GRCm39)	missense	probably damaging	0.99
R4780:Apobec3	UTSW	15	79,783,225 (GRCm39)	missense	possibly damaging	0.84
R5540:Apobec3	UTSW	15	79,782,120 (GRCm39)	missense	probably benign	0.01
R5945:Apobec3	UTSW	15	79,782,047 (GRCm39)	missense	probably damaging	1.00
R6535:Apobec3	UTSW	15	79,781,950 (GRCm39)	makesense	probably null
R9222:Apobec3	UTSW	15	79,783,270 (GRCm39)	missense
R9280:Apobec3	UTSW	15	79,791,082 (GRCm39)	missense
R9594:Apobec3	UTSW	15	79,790,653 (GRCm39)	missense
X0066:Apobec3	UTSW	15	79,789,725 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCTTGAACTTGTGCTT -3'
(R):5'- CTAGCTGTTTCTCTGCGCTG -3'

Sequencing Primer
(F):5'- TTCTCACAGGGCTAAGAGGCATC -3'
(R):5'- CTTTATGTGGGTTCCAAGGACCAAAG -3'

Posted On

2016-12-20