Incidental Mutation 'R5832:Rsph4a'
ID449359
Institutional Source Beutler Lab
Gene Symbol Rsph4a
Ensembl Gene ENSMUSG00000039552
Gene Nameradial spoke head 4 homolog A (Chlamydomonas)
SynonymsRshl3
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location33905111-33916021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33909502 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 470 (I470V)
Ref Sequence ENSEMBL: ENSMUSP00000131647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169670]
Predicted Effect probably benign
Transcript: ENSMUST00000118315
AA Change: I266V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113543
Gene: ENSMUSG00000039552
AA Change: I266V

DomainStartEndE-ValueType
Pfam:Radial_spoke 2 494 2.4e-193 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169670
AA Change: I470V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: I470V

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
Pfam:Radial_spoke 209 695 2.7e-205 PFAM
low complexity region 702 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Rsph4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Rsph4a APN 10 33914343 missense probably damaging 1.00
IGL00536:Rsph4a APN 10 33911656 splice site probably benign
IGL00702:Rsph4a APN 10 33913072 missense probably damaging 0.99
IGL02313:Rsph4a APN 10 33905525 missense possibly damaging 0.56
IGL02556:Rsph4a APN 10 33905152 utr 5 prime probably benign
PIT4519001:Rsph4a UTSW 10 33909130 missense probably benign 0.09
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0088:Rsph4a UTSW 10 33909353 missense probably benign 0.15
R0513:Rsph4a UTSW 10 33912991 nonsense probably null
R1559:Rsph4a UTSW 10 33909731 missense probably damaging 0.99
R1589:Rsph4a UTSW 10 33905529 missense probably benign 0.01
R1783:Rsph4a UTSW 10 33911636 missense probably damaging 1.00
R1914:Rsph4a UTSW 10 33913072 missense probably damaging 0.99
R2046:Rsph4a UTSW 10 33914543 unclassified probably benign
R2280:Rsph4a UTSW 10 33911599 missense probably benign 0.00
R2496:Rsph4a UTSW 10 33908098 missense possibly damaging 0.87
R3084:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R3086:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R4519:Rsph4a UTSW 10 33911627 nonsense probably null
R4965:Rsph4a UTSW 10 33909240 missense probably damaging 1.00
R5077:Rsph4a UTSW 10 33908279 missense probably damaging 1.00
R5264:Rsph4a UTSW 10 33909383 missense probably damaging 1.00
R5359:Rsph4a UTSW 10 33908236 missense probably benign 0.08
R5464:Rsph4a UTSW 10 33909341 missense possibly damaging 0.64
R5615:Rsph4a UTSW 10 33909328 missense probably benign 0.32
R5751:Rsph4a UTSW 10 33905793 missense probably damaging 0.99
R5763:Rsph4a UTSW 10 33905688 missense probably damaging 0.98
R6243:Rsph4a UTSW 10 33909143 missense probably damaging 1.00
R6654:Rsph4a UTSW 10 33912992 missense probably benign
R6918:Rsph4a UTSW 10 33905276 missense probably benign 0.00
R7081:Rsph4a UTSW 10 33909193 missense probably damaging 0.97
X0057:Rsph4a UTSW 10 33905727 missense possibly damaging 0.58
X0066:Rsph4a UTSW 10 33913009 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGGCCCCACAGGTTATACC -3'
(R):5'- GAACCCAATTGGATAGAGACTCCAC -3'

Sequencing Primer
(F):5'- TATACCTAAGGAAGAAAGTAGAACGG -3'
(R):5'- CTTGGATGCCTTCAAAGTCAG -3'
Posted On2016-12-20