Incidental Mutation 'R0547:Car5b'
ID44938
Institutional Source Beutler Lab
Gene Symbol Car5b
Ensembl Gene ENSMUSG00000031373
Gene Namecarbonic anhydrase 5b, mitochondrial
SynonymsD730005F19Rik, CAVB, 7330410H16Rik
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0547 (G1)
Quality Score223
Status Validated
ChromosomeX
Chromosomal Location163976822-164027997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 163979301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 282 (R282C)
Ref Sequence ENSEMBL: ENSMUSP00000033739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033739]
Predicted Effect probably damaging
Transcript: ENSMUST00000033739
AA Change: R282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033739
Gene: ENSMUSG00000031373
AA Change: R282C

DomainStartEndE-ValueType
Carb_anhydrase 39 296 7.37e-123 SMART
Meta Mutation Damage Score 0.6032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA, CA VA. It has a wider tissue distribution than CA VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous or hemizygous for a knock-out allele exhibit normal survival and show no detectable differences in blood ammonia or fasting glucose levels relative to control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Car5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0544:Car5b UTSW X 163979301 missense probably damaging 1.00
R0545:Car5b UTSW X 163979301 missense probably damaging 1.00
R0546:Car5b UTSW X 163979301 missense probably damaging 1.00
R0548:Car5b UTSW X 163979301 missense probably damaging 1.00
R1497:Car5b UTSW X 163988404 missense probably benign 0.31
R1863:Car5b UTSW X 163991373 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCCCGGTCTTTGCTTTACAAGAG -3'
(R):5'- TGCTGTCACACAACCATGCCAG -3'

Sequencing Primer
(F):5'- TTTGAAATGTTACCCAAAAAAGGAAG -3'
(R):5'- ggaaacagaagggggtgg -3'
Posted On2013-06-11