Incidental Mutation 'R5832:Slc39a6'
ID449386
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24601612 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 7 (V7L)
Ref Sequence ENSEMBL: ENSMUSP00000120247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120] [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070726
AA Change: V7L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: V7L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128106
Predicted Effect possibly damaging
Transcript: ENSMUST00000152504
AA Change: V7L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000154205
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Patz1 C T 11: 3,306,277 P521L probably benign Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R1885:Slc39a6 UTSW 18 24601482 unclassified probably null
R4159:Slc39a6 UTSW 18 24597828 missense possibly damaging 0.88
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R6182:Slc39a6 UTSW 18 24600956 missense probably benign 0.16
R6853:Slc39a6 UTSW 18 24599319 missense possibly damaging 0.71
R7226:Slc39a6 UTSW 18 24584027 missense probably damaging 1.00
R7252:Slc39a6 UTSW 18 24601385 missense possibly damaging 0.64
R7263:Slc39a6 UTSW 18 24601203 missense probably benign
R7328:Slc39a6 UTSW 18 24600930 missense probably benign 0.00
R7388:Slc39a6 UTSW 18 24584049 missense probably damaging 1.00
R7395:Slc39a6 UTSW 18 24585275 missense probably damaging 1.00
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGAATCATTCTCTCCGTAGCG -3'
(R):5'- TGCATCTGCTTCAGGAGACC -3'

Sequencing Primer
(F):5'- CATTCTCTCCGTAGCGGTAGAATAG -3'
(R):5'- TCTGCTTCAGGAGACCACAAG -3'
Posted On2016-12-20