Incidental Mutation 'R5833:Arhgap44'
ID449415
Institutional Source Beutler Lab
Gene Symbol Arhgap44
Ensembl Gene ENSMUSG00000033389
Gene NameRho GTPase activating protein 44
SynonymsAU040829
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5833 (G1)
Quality Score121
Status Not validated
Chromosome11
Chromosomal Location65002039-65162961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65038677 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 267 (E267A)
Ref Sequence ENSEMBL: ENSMUSP00000090681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000093002]
Predicted Effect probably damaging
Transcript: ENSMUST00000047463
AA Change: E267A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389
AA Change: E267A

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093002
AA Change: E267A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389
AA Change: E267A

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119723
Predicted Effect unknown
Transcript: ENSMUST00000130420
AA Change: E141A
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389
AA Change: E141A

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arl11 T A 14: 61,311,062 L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gm6309 A G 5: 146,168,318 S262P probably damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtmr4 T A 11: 87,605,049 Y570* probably null Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in Arhgap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgap44 APN 11 65041449 missense probably damaging 0.96
IGL01553:Arhgap44 APN 11 65053118 missense probably damaging 1.00
IGL01868:Arhgap44 APN 11 65012078 missense probably damaging 1.00
IGL01996:Arhgap44 APN 11 65005496 utr 3 prime probably benign
IGL02093:Arhgap44 APN 11 65074534 missense probably damaging 1.00
IGL02962:Arhgap44 APN 11 65067161 splice site probably benign
IGL02963:Arhgap44 APN 11 65031663 missense probably damaging 1.00
IGL03032:Arhgap44 APN 11 65024212 missense probably damaging 1.00
R0071:Arhgap44 UTSW 11 65011895 missense possibly damaging 0.90
R0152:Arhgap44 UTSW 11 65011919 missense probably benign 0.13
R0402:Arhgap44 UTSW 11 65032077 splice site probably benign
R1109:Arhgap44 UTSW 11 65026816 missense probably benign 0.00
R1694:Arhgap44 UTSW 11 65053197 missense probably damaging 1.00
R1946:Arhgap44 UTSW 11 65012096 missense probably damaging 0.99
R2036:Arhgap44 UTSW 11 65041492 missense possibly damaging 0.83
R2356:Arhgap44 UTSW 11 65010025 missense probably damaging 1.00
R4342:Arhgap44 UTSW 11 65012061 nonsense probably null
R4657:Arhgap44 UTSW 11 65005452 critical splice donor site probably null
R4763:Arhgap44 UTSW 11 65039165 missense probably damaging 0.98
R4803:Arhgap44 UTSW 11 65053095 missense probably benign 0.00
R5652:Arhgap44 UTSW 11 65024238 missense probably damaging 1.00
R5663:Arhgap44 UTSW 11 65024291 missense probably damaging 1.00
R6000:Arhgap44 UTSW 11 65032084 frame shift probably null
R6001:Arhgap44 UTSW 11 65032084 frame shift probably null
R6046:Arhgap44 UTSW 11 65032084 frame shift probably null
R6066:Arhgap44 UTSW 11 65032084 frame shift probably null
R6160:Arhgap44 UTSW 11 65162549 unclassified probably benign
R6661:Arhgap44 UTSW 11 65010008 missense probably damaging 0.97
R7062:Arhgap44 UTSW 11 65011932 missense probably benign 0.25
X0022:Arhgap44 UTSW 11 65053212 missense probably damaging 1.00
X0061:Arhgap44 UTSW 11 65038645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAAGAGAATGCAGTGCC -3'
(R):5'- TCTTTGGTACTCTGTGCAGAATC -3'

Sequencing Primer
(F):5'- TCTGCAGAAGAGACAATATTGCC -3'
(R):5'- TACTCTGTGCAGAATCTGGATAAGG -3'
Posted On2016-12-20