Incidental Mutation 'R5833:Arl11'
ID449422
Institutional Source Beutler Lab
Gene Symbol Arl11
Ensembl Gene ENSMUSG00000043157
Gene NameADP-ribosylation factor-like 11
SynonymsARLTS1, C730007L20Rik
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R5833 (G1)
Quality Score206
Status Not validated
Chromosome14
Chromosomal Location61309753-61311936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61311062 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 107 (L107Q)
Ref Sequence ENSEMBL: ENSMUSP00000153531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055159] [ENSMUST00000224727]
Predicted Effect probably damaging
Transcript: ENSMUST00000055159
AA Change: L107Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055447
Gene: ENSMUSG00000043157
AA Change: L107Q

DomainStartEndE-ValueType
ARF 1 176 4.96e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188538
Predicted Effect probably damaging
Transcript: ENSMUST00000224727
AA Change: L107Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor related to the ADP-ribosylation factor (ARF) family of proteins. The encoded protein may play a role in apoptosis in a caspase-dependent manner. Polymorphisms in this gene have been associated with some familial cancers. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arhgap44 T G 11: 65,038,677 E267A probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gm6309 A G 5: 146,168,318 S262P probably damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtmr4 T A 11: 87,605,049 Y570* probably null Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in Arl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Arl11 APN 14 61311242 missense probably benign 0.22
IGL02158:Arl11 APN 14 61311038 missense probably damaging 0.99
IGL02756:Arl11 APN 14 61311086 missense probably damaging 1.00
R1755:Arl11 UTSW 14 61310944 missense probably benign
R4688:Arl11 UTSW 14 61311097 missense probably benign 0.16
R6438:Arl11 UTSW 14 61310944 missense probably benign
R7129:Arl11 UTSW 14 61310897 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCACTGTTGGTTTTAATGTAGAGCC -3'
(R):5'- GACTTCAGCAAATGCAGCAGG -3'

Sequencing Primer
(F):5'- CTCTTGAGGCTCCTGGACATG -3'
(R):5'- CAGCAAATGCAGCAGGCTCTG -3'
Posted On2016-12-20