Incidental Mutation 'R5834:Spag16'
ID449433
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission 044055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5834 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69923714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 340 (M340K)
Ref Sequence ENSEMBL: ENSMUSP00000109573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably benign
Transcript: ENSMUST00000065425
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113940
AA Change: M340K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: M340K

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G A 8: 105,282,123 Q421* probably null Het
Abca13 T C 11: 9,277,974 probably null Het
Adamts20 A C 15: 94,353,584 S441A probably damaging Het
Aen T A 7: 78,907,301 M299K probably damaging Het
Akap3 T C 6: 126,865,833 S472P probably benign Het
Ank3 T G 10: 69,822,257 V158G probably damaging Het
Arfgap1 A G 2: 180,981,162 D324G probably benign Het
Aste1 A T 9: 105,403,415 R448S probably benign Het
Atp10a T A 7: 58,658,618 L55Q probably benign Het
C1qtnf9 G A 14: 60,779,450 G143D probably damaging Het
Camsap2 A G 1: 136,280,388 V1122A probably benign Het
Cbl T C 9: 44,233,779 H37R probably damaging Het
Cfap61 A C 2: 146,129,149 D893A probably benign Het
Chd2 T A 7: 73,478,715 I841F probably damaging Het
Chd9 A G 8: 90,997,164 T622A probably damaging Het
Cntnap3 A G 13: 64,748,577 Y1028H probably benign Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp2c55 A G 19: 39,042,067 I448V probably benign Het
Cyth1 T A 11: 118,192,463 probably null Het
Dcaf13 C T 15: 39,143,642 R324* probably null Het
Dhx37 C A 5: 125,425,730 R42L probably damaging Het
Dock1 T A 7: 134,763,933 V450E probably damaging Het
Ednrb A G 14: 103,820,877 L330P probably damaging Het
Eml4 T A 17: 83,477,741 H778Q probably damaging Het
Evx1 T A 6: 52,315,990 I227N probably damaging Het
G3bp1 T A 11: 55,497,940 V326E probably benign Het
Gata2 T C 6: 88,200,747 V253A probably benign Het
Gbp2 A G 3: 142,633,377 N397D probably damaging Het
Gm14401 C A 2: 177,086,903 H261N probably benign Het
Hacd4 A T 4: 88,398,152 H243Q probably benign Het
Hsd3b1 C A 3: 98,852,939 K245N possibly damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ift27 A T 15: 78,165,243 C86S probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irs3 T A 5: 137,644,559 S206C probably damaging Het
Lefty2 C T 1: 180,893,151 probably benign Het
Mark3 A G 12: 111,624,487 I162V probably damaging Het
Mefv A C 16: 3,716,046 D120E probably damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mre11a A G 9: 14,799,657 I45V probably benign Het
Mtor A G 4: 148,536,536 N1797S possibly damaging Het
Nav1 A C 1: 135,532,406 M393R probably benign Het
Nod2 T C 8: 88,664,639 S510P possibly damaging Het
Nos2 C T 11: 78,928,579 T39I probably benign Het
Olfr474 T A 7: 107,954,906 H88Q probably benign Het
Olfr93 A T 17: 37,151,799 Y58N probably damaging Het
Pcdh7 A G 5: 57,721,628 S842G possibly damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Plaa A C 4: 94,583,469 V10G probably damaging Het
Pprc1 T A 19: 46,065,220 probably benign Het
Ptprt T C 2: 161,560,269 Y994C probably damaging Het
Ripply2 T A 9: 87,015,890 W37R probably damaging Het
Rpgrip1 A G 14: 52,158,382 D1227G probably damaging Het
Scoc C T 8: 83,437,631 D10N possibly damaging Het
Sdk2 A T 11: 113,854,273 I732N probably damaging Het
Six2 T C 17: 85,687,664 K97E probably damaging Het
Slit2 A C 5: 48,259,647 N1014H probably damaging Het
Smc1b A C 15: 85,089,665 L930R probably damaging Het
Spata31 C T 13: 64,922,666 S876L probably benign Het
Spen A G 4: 141,471,843 Y3135H possibly damaging Het
Spta1 A T 1: 174,184,797 probably null Het
Stk3 G A 15: 34,959,018 T336I probably damaging Het
Tas2r118 T A 6: 23,969,877 T62S probably benign Het
Tmprss11d A G 5: 86,306,310 M212T probably damaging Het
Trpc7 A G 13: 56,776,158 L738P probably damaging Het
Ttll8 A G 15: 88,917,246 V413A possibly damaging Het
Usb1 G A 8: 95,333,533 probably benign Het
Vmn1r238 T C 18: 3,123,168 E82G probably benign Het
Vmn2r114 T C 17: 23,310,625 T168A possibly damaging Het
Vmn2r60 C A 7: 42,116,508 P13H probably benign Het
Wdr26 A G 1: 181,203,147 L194P probably damaging Het
Zfhx2 G A 14: 55,073,330 Q636* probably null Het
Zfyve26 A G 12: 79,266,537 Y25H probably benign Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGGAACTCAAAAGCCAAAGTTTG -3'
(R):5'- ATTTGACTCATGCTGATGGAGAC -3'

Sequencing Primer
(F):5'- CCTTTAAAACATTTTCTCCATGCAG -3'
(R):5'- ACAAGAGGTCTTCGGTGGTC -3'
Posted On2016-12-20