Incidental Mutation 'R5834:Nav1'
ID449435
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission 044055-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5834 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 135532406 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 393 (M393R)
Ref Sequence ENSEMBL: ENSMUSP00000140322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably benign
Transcript: ENSMUST00000040599
AA Change: M393R

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: M393R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067414
AA Change: M393R

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: M393R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190298
AA Change: M393R

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: M393R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G A 8: 105,282,123 Q421* probably null Het
Abca13 T C 11: 9,277,974 probably null Het
Adamts20 A C 15: 94,353,584 S441A probably damaging Het
Aen T A 7: 78,907,301 M299K probably damaging Het
Akap3 T C 6: 126,865,833 S472P probably benign Het
Ank3 T G 10: 69,822,257 V158G probably damaging Het
Arfgap1 A G 2: 180,981,162 D324G probably benign Het
Aste1 A T 9: 105,403,415 R448S probably benign Het
Atp10a T A 7: 58,658,618 L55Q probably benign Het
C1qtnf9 G A 14: 60,779,450 G143D probably damaging Het
Camsap2 A G 1: 136,280,388 V1122A probably benign Het
Cbl T C 9: 44,233,779 H37R probably damaging Het
Cfap61 A C 2: 146,129,149 D893A probably benign Het
Chd2 T A 7: 73,478,715 I841F probably damaging Het
Chd9 A G 8: 90,997,164 T622A probably damaging Het
Cntnap3 A G 13: 64,748,577 Y1028H probably benign Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp2c55 A G 19: 39,042,067 I448V probably benign Het
Cyth1 T A 11: 118,192,463 probably null Het
Dcaf13 C T 15: 39,143,642 R324* probably null Het
Dhx37 C A 5: 125,425,730 R42L probably damaging Het
Dock1 T A 7: 134,763,933 V450E probably damaging Het
Ednrb A G 14: 103,820,877 L330P probably damaging Het
Eml4 T A 17: 83,477,741 H778Q probably damaging Het
Evx1 T A 6: 52,315,990 I227N probably damaging Het
G3bp1 T A 11: 55,497,940 V326E probably benign Het
Gata2 T C 6: 88,200,747 V253A probably benign Het
Gbp2 A G 3: 142,633,377 N397D probably damaging Het
Gm14401 C A 2: 177,086,903 H261N probably benign Het
Hacd4 A T 4: 88,398,152 H243Q probably benign Het
Hsd3b1 C A 3: 98,852,939 K245N possibly damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ift27 A T 15: 78,165,243 C86S probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irs3 T A 5: 137,644,559 S206C probably damaging Het
Lefty2 C T 1: 180,893,151 probably benign Het
Mark3 A G 12: 111,624,487 I162V probably damaging Het
Mefv A C 16: 3,716,046 D120E probably damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mre11a A G 9: 14,799,657 I45V probably benign Het
Mtor A G 4: 148,536,536 N1797S possibly damaging Het
Nod2 T C 8: 88,664,639 S510P possibly damaging Het
Nos2 C T 11: 78,928,579 T39I probably benign Het
Olfr474 T A 7: 107,954,906 H88Q probably benign Het
Olfr93 A T 17: 37,151,799 Y58N probably damaging Het
Pcdh7 A G 5: 57,721,628 S842G possibly damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Plaa A C 4: 94,583,469 V10G probably damaging Het
Pprc1 T A 19: 46,065,220 probably benign Het
Ptprt T C 2: 161,560,269 Y994C probably damaging Het
Ripply2 T A 9: 87,015,890 W37R probably damaging Het
Rpgrip1 A G 14: 52,158,382 D1227G probably damaging Het
Scoc C T 8: 83,437,631 D10N possibly damaging Het
Sdk2 A T 11: 113,854,273 I732N probably damaging Het
Six2 T C 17: 85,687,664 K97E probably damaging Het
Slit2 A C 5: 48,259,647 N1014H probably damaging Het
Smc1b A C 15: 85,089,665 L930R probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Spata31 C T 13: 64,922,666 S876L probably benign Het
Spen A G 4: 141,471,843 Y3135H possibly damaging Het
Spta1 A T 1: 174,184,797 probably null Het
Stk3 G A 15: 34,959,018 T336I probably damaging Het
Tas2r118 T A 6: 23,969,877 T62S probably benign Het
Tmprss11d A G 5: 86,306,310 M212T probably damaging Het
Trpc7 A G 13: 56,776,158 L738P probably damaging Het
Ttll8 A G 15: 88,917,246 V413A possibly damaging Het
Usb1 G A 8: 95,333,533 probably benign Het
Vmn1r238 T C 18: 3,123,168 E82G probably benign Het
Vmn2r114 T C 17: 23,310,625 T168A possibly damaging Het
Vmn2r60 C A 7: 42,116,508 P13H probably benign Het
Wdr26 A G 1: 181,203,147 L194P probably damaging Het
Zfhx2 G A 14: 55,073,330 Q636* probably null Het
Zfyve26 A G 12: 79,266,537 Y25H probably benign Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCACCTTAGGCACAGCAG -3'
(R):5'- TTGTTACGACAGCGATGACG -3'

Sequencing Primer
(F):5'- TTAGGCACAGCAGCACTCTG -3'
(R):5'- GAAGCGTGTCCAGTCTCTC -3'
Posted On2016-12-20