Incidental Mutation 'R5835:Slc1a2'
ID449522
Institutional Source Beutler Lab
Gene Symbol Slc1a2
Ensembl Gene ENSMUSG00000005089
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location102658659-102790784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102777450 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 481 (N481S)
Ref Sequence ENSEMBL: ENSMUSP00000106844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213]
Predicted Effect probably damaging
Transcript: ENSMUST00000005220
AA Change: N478S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089
AA Change: N478S

DomainStartEndE-ValueType
Pfam:SDF 43 492 8.9e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080210
AA Change: N481S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089
AA Change: N481S

DomainStartEndE-ValueType
Pfam:SDF 46 495 3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111212
AA Change: N478S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089
AA Change: N478S

DomainStartEndE-ValueType
Pfam:SDF 43 492 9.5e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111213
AA Change: N481S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089
AA Change: N481S

DomainStartEndE-ValueType
Pfam:SDF 46 495 2e-134 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136488
AA Change: N151S
SMART Domains Protein: ENSMUSP00000122094
Gene: ENSMUSG00000005089
AA Change: N151S

DomainStartEndE-ValueType
Pfam:SDF 1 144 2.6e-53 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154446
AA Change: N65S
SMART Domains Protein: ENSMUSP00000117549
Gene: ENSMUSG00000005089
AA Change: N65S

DomainStartEndE-ValueType
Pfam:SDF 1 80 5.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Slc1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc1a2 APN 2 102777576 missense possibly damaging 0.55
IGL00588:Slc1a2 APN 2 102756001 missense probably benign
IGL00931:Slc1a2 APN 2 102756112 missense probably damaging 1.00
IGL00942:Slc1a2 APN 2 102739814 missense probably damaging 1.00
IGL02100:Slc1a2 APN 2 102756089 missense probably damaging 1.00
IGL02173:Slc1a2 APN 2 102743861 missense probably benign 0.05
IGL02184:Slc1a2 APN 2 102748544 missense probably damaging 1.00
IGL02480:Slc1a2 APN 2 102736066 missense probably damaging 1.00
IGL02643:Slc1a2 APN 2 102739880 missense probably benign 0.30
IGL03332:Slc1a2 APN 2 102748534 missense possibly damaging 0.96
R0335:Slc1a2 UTSW 2 102743863 missense probably benign
R0544:Slc1a2 UTSW 2 102756072 missense probably damaging 0.99
R0570:Slc1a2 UTSW 2 102756007 missense probably damaging 1.00
R1472:Slc1a2 UTSW 2 102737909 missense probably damaging 1.00
R1536:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R1856:Slc1a2 UTSW 2 102777567 missense probably damaging 0.97
R1936:Slc1a2 UTSW 2 102777605 missense probably benign 0.04
R1965:Slc1a2 UTSW 2 102739900 missense probably damaging 1.00
R2270:Slc1a2 UTSW 2 102735994 missense probably damaging 1.00
R2365:Slc1a2 UTSW 2 102748453 intron probably null
R2567:Slc1a2 UTSW 2 102767010 missense probably damaging 1.00
R2878:Slc1a2 UTSW 2 102761167 missense probably damaging 1.00
R3080:Slc1a2 UTSW 2 102748556 missense probably damaging 1.00
R4716:Slc1a2 UTSW 2 102748538 missense probably damaging 0.96
R4744:Slc1a2 UTSW 2 102737869 missense probably benign 0.41
R5197:Slc1a2 UTSW 2 102756115 missense probably benign 0.02
R7077:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
X0065:Slc1a2 UTSW 2 102737831 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAATGTAGTGAGCTTTCCTGG -3'
(R):5'- TTGTGTGCGGCATAGACAC -3'

Sequencing Primer
(F):5'- CCTGGTGATGATTTTCTAAGATGAG -3'
(R):5'- GCATAGACACACTGATTAGAGTTGC -3'
Posted On2016-12-20