Incidental Mutation 'R5835:Casp2'
ID449536
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Namecaspase 2
SynonymsNedd2, Caspase-2, Ich-1
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42264985-42282508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42267586 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 54 (S54R)
Ref Sequence ENSEMBL: ENSMUSP00000121184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000095987] [ENSMUST00000156829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031895
AA Change: S54R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: S54R

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095987
SMART Domains Protein: ENSMUSP00000100590
Gene: ENSMUSG00000071506

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:TMEM51 58 194 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144821
Predicted Effect possibly damaging
Transcript: ENSMUST00000156829
AA Change: S54R

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863
AA Change: S54R

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42269285 nonsense probably null
IGL02094:Casp2 APN 6 42280359 missense probably damaging 1.00
IGL02371:Casp2 APN 6 42267968 missense probably benign 0.00
IGL02414:Casp2 APN 6 42280446 missense probably damaging 1.00
IGL03298:Casp2 APN 6 42268990 splice site probably benign
R1240:Casp2 UTSW 6 42268945 missense probably damaging 1.00
R1424:Casp2 UTSW 6 42276791 splice site probably benign
R1672:Casp2 UTSW 6 42268908 missense probably damaging 1.00
R4110:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R4113:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R5062:Casp2 UTSW 6 42269272 splice site probably benign
R5469:Casp2 UTSW 6 42269334 missense probably benign 0.00
R5877:Casp2 UTSW 6 42276637 intron probably benign
R6103:Casp2 UTSW 6 42279880 missense probably damaging 0.99
R6667:Casp2 UTSW 6 42279836 missense probably damaging 1.00
R6702:Casp2 UTSW 6 42268051 missense probably benign
R6754:Casp2 UTSW 6 42269330 missense probably damaging 1.00
R7141:Casp2 UTSW 6 42280395 missense possibly damaging 0.68
X0065:Casp2 UTSW 6 42280143 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTTAGGGTCAGCATATTACTGC -3'
(R):5'- TCTATCAAACTCTCAAGCCGG -3'

Sequencing Primer
(F):5'- GGGTCAGCATATTACTGCATAGTAC -3'
(R):5'- ACTCTCAAGCCGGACAAGGG -3'
Posted On2016-12-20