Incidental Mutation 'R5835:Crybg1'
ID449548
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43975133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1581 (T1581S)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably benign
Transcript: ENSMUST00000020017
AA Change: T1207S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: T1207S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: T1581S

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: T1581S

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense not run
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACAACAGCCTGGGGTTC -3'
(R):5'- GGTCTCACACATGCTGGACAAG -3'

Sequencing Primer
(F):5'- CTGGGGTTCAGTCTCCATGAC -3'
(R):5'- CCCTTCTATTGCAGGTAGT -3'
Posted On2016-12-20