Mutagenetix > Incidental Mutation

Incidental Mutation 'R5836:Azin2'

449579

Institutional Source

Beutler Lab

Gene Symbol

Azin2

Ensembl Gene

ENSMUSG00000028789

Gene Name

antizyme inhibitor 2

Synonyms

Adc, Odcp, 4933429I20Rik, AZIN2

MMRRC Submission

043222-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.300) question?

Stock #

R5836 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128824026-128856235 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128842670 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 128 (G128D)

Ref Sequence

ENSEMBL: ENSMUSP00000114086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354] [ENSMUST00000147731]

AlphaFold

Q8BVM4

Predicted Effect

probably damaging
Transcript: ENSMUST00000030581
AA Change: G223D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: G223D

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	1.9e-69	PFAM
Pfam:Orn_DAP_Arg_deC	286	407	1.7e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106068
AA Change: G223D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: G223D

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	6.7e-73	PFAM
Pfam:Orn_DAP_Arg_deC	287	406	1.9e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119354
AA Change: G128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: G128D

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	1	188	4.2e-54	PFAM
Pfam:Orn_DAP_Arg_deC	191	312	4.3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143912

Predicted Effect

probably damaging
Transcript: ENSMUST00000147731
AA Change: G142D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122240
Gene: ENSMUSG00000028789
AA Change: G142D

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	2	202	4e-56	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	G	T	17: 36,272,918 (GRCm39)	A243D	possibly damaging	Het
Babam1	A	G	8: 71,855,687 (GRCm39)	E260G	probably benign	Het
Brwd1	A	T	16: 95,865,958 (GRCm39)	S275T	probably damaging	Het
Cd8a	T	C	6: 71,350,775 (GRCm39)	V80A	possibly damaging	Het
Clec4a3	T	C	6: 122,929,861 (GRCm39)	F12S	possibly damaging	Het
Dennd2b	A	T	7: 109,140,552 (GRCm39)	S225T	possibly damaging	Het
Dnah5	A	C	15: 28,383,738 (GRCm39)	N2987H	probably damaging	Het
Dock9	A	G	14: 121,918,763 (GRCm39)	F78S	probably damaging	Het
Eml3	A	G	19: 8,918,659 (GRCm39)	T885A	possibly damaging	Het
Esr1	T	C	10: 4,662,817 (GRCm39)	V145A	probably benign	Het
Gm5108	A	G	5: 68,101,953 (GRCm39)		probably benign	Het
Gpr179	T	C	11: 97,229,882 (GRCm39)	S758G	probably benign	Het
Heatr1	T	A	13: 12,423,617 (GRCm39)	L538Q	probably damaging	Het
Ikzf2	A	G	1: 69,578,546 (GRCm39)	I176T	probably damaging	Het
Lrp3	A	G	7: 34,902,747 (GRCm39)	V533A	probably damaging	Het
Nkx2-5	A	T	17: 27,058,063 (GRCm39)	V297E	possibly damaging	Het
Or13a19	G	A	7: 139,902,827 (GRCm39)	V72I	probably benign	Het
Or2y16	T	C	11: 49,335,353 (GRCm39)	L225P	probably damaging	Het
Or8g23	T	C	9: 38,971,918 (GRCm39)	T15A	probably benign	Het
Pclo	T	A	5: 14,728,549 (GRCm39)		probably benign	Het
Pdgfra	T	C	5: 75,324,435 (GRCm39)	W97R	possibly damaging	Het
Plekha5	T	C	6: 140,372,250 (GRCm39)	Y67H	probably damaging	Het
Plin5	A	T	17: 56,422,549 (GRCm39)		probably null	Het
Pramel11	A	G	4: 143,623,490 (GRCm39)	V228A	probably benign	Het
Prickle1	T	A	15: 93,400,898 (GRCm39)	K529*	probably null	Het
Ptbp2	G	A	3: 119,519,746 (GRCm39)	T107I	probably damaging	Het
Ptpn12	C	T	5: 21,214,544 (GRCm39)	W197*	probably null	Het
Rhobtb1	T	C	10: 69,105,819 (GRCm39)	V128A	probably damaging	Het
Ryr2	T	C	13: 11,618,618 (GRCm39)	T3866A	probably damaging	Het
Serpina3m	T	C	12: 104,355,509 (GRCm39)	Y59H	probably damaging	Het
Slc12a6	T	C	2: 112,172,343 (GRCm39)	V414A	possibly damaging	Het
Slc34a1	T	C	13: 55,561,278 (GRCm39)	M581T	probably benign	Het
Slco1c1	A	G	6: 141,515,040 (GRCm39)	Y596C	probably damaging	Het
Stoml1	T	C	9: 58,168,123 (GRCm39)	L278P	probably benign	Het
Tecpr2	C	T	12: 110,897,945 (GRCm39)	A399V	possibly damaging	Het
Tmem229a	T	C	6: 24,955,016 (GRCm39)	E246G	probably damaging	Het
Vmn1r224	A	T	17: 20,639,953 (GRCm39)	I177L	probably benign	Het
Zswim5	C	T	4: 116,842,000 (GRCm39)	T860I	probably benign	Het

Other mutations in Azin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Azin2	APN	4	128,844,459 (GRCm39)	missense	probably damaging	1.00
IGL02040:Azin2	APN	4	128,844,451 (GRCm39)	missense	possibly damaging	0.78
IGL03349:Azin2	APN	4	128,839,907 (GRCm39)	nonsense	probably null
R0118:Azin2	UTSW	4	128,843,430 (GRCm39)	missense	probably damaging	0.97
R1215:Azin2	UTSW	4	128,843,489 (GRCm39)	missense	probably damaging	0.96
R1940:Azin2	UTSW	4	128,844,577 (GRCm39)	splice site	probably null
R2939:Azin2	UTSW	4	128,828,397 (GRCm39)	missense	probably benign	0.44
R4899:Azin2	UTSW	4	128,828,446 (GRCm39)	missense	probably benign	0.43
R6511:Azin2	UTSW	4	128,828,259 (GRCm39)	missense	probably damaging	1.00
R9059:Azin2	UTSW	4	128,828,440 (GRCm39)	missense	probably benign	0.03
R9209:Azin2	UTSW	4	128,841,341 (GRCm39)	missense	probably damaging	0.99
R9266:Azin2	UTSW	4	128,856,230 (GRCm39)	unclassified	probably benign
R9595:Azin2	UTSW	4	128,853,617 (GRCm39)	missense	probably benign	0.03
T0722:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
T0975:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
Z1176:Azin2	UTSW	4	128,828,452 (GRCm39)	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- CAAGCCCAAGGTGTTGACAG -3'
(R):5'- AGAAGTGCCACCTTTCTGTTC -3'

Sequencing Primer
(F):5'- TGTTGACAGTCGGGCCAAAG -3'
(R):5'- GTGGCCCTCTGTAGCCTATG -3'

Posted On

2016-12-20