Incidental Mutation 'R5836:Plekha5'
ID449589
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 043222-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5836 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140426524 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 67 (Y67H)
Ref Sequence ENSEMBL: ENSMUSP00000084904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000204145]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: Y67H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: Y67H

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203517
AA Change: Y67H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: Y67H

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204145
AA Change: Y67H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: Y67H

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G T 17: 35,962,026 A243D possibly damaging Het
Azin2 C T 4: 128,948,877 G128D probably damaging Het
Babam1 A G 8: 71,403,043 E260G probably benign Het
Brwd1 A T 16: 96,064,758 S275T probably damaging Het
Cd8a T C 6: 71,373,791 V80A possibly damaging Het
Clec4a3 T C 6: 122,952,902 F12S possibly damaging Het
Dnah5 A C 15: 28,383,592 N2987H probably damaging Het
Dock9 A G 14: 121,681,351 F78S probably damaging Het
Eml3 A G 19: 8,941,295 T885A possibly damaging Het
Esr1 T C 10: 4,712,817 V145A probably benign Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gpr179 T C 11: 97,339,056 S758G probably benign Het
Heatr1 T A 13: 12,408,736 L538Q probably damaging Het
Ikzf2 A G 1: 69,539,387 I176T probably damaging Het
Lrp3 A G 7: 35,203,322 V533A probably damaging Het
Nkx2-5 A T 17: 26,839,089 V297E possibly damaging Het
Olfr1388 T C 11: 49,444,526 L225P probably damaging Het
Olfr525 G A 7: 140,322,914 V72I probably benign Het
Olfr937 T C 9: 39,060,622 T15A probably benign Het
Pclo T A 5: 14,678,535 probably benign Het
Pdgfra T C 5: 75,163,774 W97R possibly damaging Het
Plin5 A T 17: 56,115,549 probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prickle1 T A 15: 93,503,017 K529* probably null Het
Ptbp2 G A 3: 119,726,097 T107I probably damaging Het
Ptpn12 C T 5: 21,009,546 W197* probably null Het
Rhobtb1 T C 10: 69,269,989 V128A probably damaging Het
Ryr2 T C 13: 11,603,732 T3866A probably damaging Het
Serpina3m T C 12: 104,389,250 Y59H probably damaging Het
Slc12a6 T C 2: 112,341,998 V414A possibly damaging Het
Slc34a1 T C 13: 55,413,465 M581T probably benign Het
Slco1c1 A G 6: 141,569,314 Y596C probably damaging Het
St5 A T 7: 109,541,345 S225T possibly damaging Het
Stoml1 T C 9: 58,260,840 L278P probably benign Het
Tecpr2 C T 12: 110,931,511 A399V possibly damaging Het
Tmem229a T C 6: 24,955,017 E246G probably damaging Het
Vmn1r224 A T 17: 20,419,691 I177L probably benign Het
Zswim5 C T 4: 116,984,803 T860I probably benign Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGACCACTGTTAAAGGG -3'
(R):5'- AACAAGATAATGAATGAGGCTACCC -3'

Sequencing Primer
(F):5'- GGTCATCTCAAATATTGCTGGAAC -3'
(R):5'- AGGCTACCCTCTCCCTCAAAATTTC -3'
Posted On2016-12-20