Incidental Mutation 'R5837:Stoml2'
ID449636
Institutional Source Beutler Lab
Gene Symbol Stoml2
Ensembl Gene ENSMUSG00000028455
Gene Namestomatin (Epb7.2)-like 2
Synonyms0610038F01Rik, SLP-2
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43027690-43031710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43028989 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 248 (N248K)
Ref Sequence ENSEMBL: ENSMUSP00000117586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000067481] [ENSMUST00000098109] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030]
Predicted Effect probably damaging
Transcript: ENSMUST00000030169
AA Change: N294K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455
AA Change: N294K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036462
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067481
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098109
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107956
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107957
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107958
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107959
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135660
AA Change: N252K
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455
AA Change: N252K

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136326
AA Change: N248K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455
AA Change: N248K

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect probably benign
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated in T cells exhibit normal mitochondria migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Stoml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Stoml2 APN 4 43029366 unclassified probably benign
IGL02498:Stoml2 APN 4 43031045 missense probably benign 0.01
IGL03185:Stoml2 APN 4 43029065 missense probably benign 0.13
R0329:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R0330:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R1344:Stoml2 UTSW 4 43028197 missense probably benign 0.00
R2202:Stoml2 UTSW 4 43030243 nonsense probably null
R2203:Stoml2 UTSW 4 43030243 nonsense probably null
R2204:Stoml2 UTSW 4 43030243 nonsense probably null
R2205:Stoml2 UTSW 4 43030243 nonsense probably null
R4804:Stoml2 UTSW 4 43029882 missense probably benign 0.01
R4952:Stoml2 UTSW 4 43029589 missense probably benign 0.02
R5845:Stoml2 UTSW 4 43030008 unclassified probably benign
R5882:Stoml2 UTSW 4 43031003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTCTGAGCCTTGCAAAC -3'
(R):5'- AAGCCAGATTATGTGAGCTTTGTG -3'

Sequencing Primer
(F):5'- TCTGAGCCTTGCAAACAATTC -3'
(R):5'- GTTAGGATTTGTATAGCCCCTTTTC -3'
Posted On2016-12-20