Incidental Mutation 'R5837:Nudt1'
ID449642
Institutional Source Beutler Lab
Gene Symbol Nudt1
Ensembl Gene ENSMUSG00000036639
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 1
SynonymsMth1, 8-oxo-7,8-dihydro-2'-dGTPase
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5837 (G1)
Quality Score176
Status Validated
Chromosome5
Chromosomal Location140321656-140338137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140334540 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 25 (R25G)
Ref Sequence ENSEMBL: ENSMUSP00000106449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031536] [ENSMUST00000050205] [ENSMUST00000071881] [ENSMUST00000110825] [ENSMUST00000110826] [ENSMUST00000110827] [ENSMUST00000198660]
Predicted Effect probably benign
Transcript: ENSMUST00000031536
SMART Domains Protein: ENSMUSP00000031536
Gene: ENSMUSG00000029557

DomainStartEndE-ValueType
Pfam:FtsJ 52 237 8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050205
AA Change: R25G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059983
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 6.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071881
AA Change: R25G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071778
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110825
AA Change: R25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106449
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 103 4.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110826
AA Change: R25G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106450
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110827
AA Change: R25G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106451
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145898
SMART Domains Protein: ENSMUSP00000120347
Gene: ENSMUSG00000036639

DomainStartEndE-ValueType
Pfam:NUDIX 1 64 1.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198660
AA Change: R25G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143140
Gene: ENSMUSG00000036639
AA Change: R25G

DomainStartEndE-ValueType
Pfam:NUDIX 4 112 2.1e-15 PFAM
Meta Mutation Damage Score 0.0212 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele show increased incidence of tumor formation in the lung, liver and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Nudt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Nudt1 APN 5 140337710 missense probably damaging 1.00
IGL02171:Nudt1 APN 5 140337593 missense probably damaging 1.00
R0830:Nudt1 UTSW 5 140335321 unclassified probably null
R1676:Nudt1 UTSW 5 140334623 splice site probably null
R5073:Nudt1 UTSW 5 140331907 unclassified probably null
R7211:Nudt1 UTSW 5 140337647 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGAATGTATCTCCCTCCCACC -3'
(R):5'- GCAGAGGCATTGCTATAACTAGTTG -3'

Sequencing Primer
(F):5'- CTGGCCACAACAGAACTCATATGATG -3'
(R):5'- CATGGTCTACATAGCATCGGTCAG -3'
Posted On2016-12-20