Incidental Mutation 'R5837:Loxhd1'
ID449683
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77286409 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 59 (T59A)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: T59A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: T59A

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCGAGCTTTCAGAGTC -3'
(R):5'- CATTTAACATGCCTGTGGTCC -3'

Sequencing Primer
(F):5'- CCAAAGCAGTGTGTGGTATTGAG -3'
(R):5'- AACATGCCTGTGGTCCAACTG -3'
Posted On2016-12-20