Mutagenetix > Incidental Mutations

Incidental Mutation 'R5838:Reln'

449709

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R5838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21899113 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 3287 (I3287F)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: I3287F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: I3287F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160791

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: I3287F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: I3287F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200667

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	G	A	11: 105,972,880	V385I	probably benign	Het
Apmap	T	C	2: 150,585,857	Y315C	probably damaging	Het
Arhgef12	G	A	9: 43,005,608	T414I	probably damaging	Het
Cd200r1	C	A	16: 44,766,034	A9D	possibly damaging	Het
Cdkal1	T	C	13: 29,691,686	D183G	probably benign	Het
Clk1	C	A	1: 58,412,660	C432F	probably damaging	Het
Col27a1	G	T	4: 63,225,528	L484F	probably damaging	Het
Col7a1	A	G	9: 108,978,143	E2480G	unknown	Het
D430042O09Rik	A	T	7: 125,867,655	M1361L	possibly damaging	Het
Dnah5	A	G	15: 28,290,195	I1244V	probably benign	Het
Dock3	G	T	9: 106,895,488	P522Q	possibly damaging	Het
Drc1	T	A	5: 30,366,513		probably null	Het
Epas1	C	T	17: 86,823,686	T298I	possibly damaging	Het
Epha1	A	T	6: 42,361,646	I699N	probably damaging	Het
Ephb3	T	C	16: 21,221,687	S558P	probably damaging	Het
Epn1	T	A	7: 5,097,166	L426*	probably null	Het
Fam234b	T	C	6: 135,225,267	V329A	probably benign	Het
Fasn	G	T	11: 120,816,124	R901S	probably damaging	Het
Fbln2	T	C	6: 91,271,848	M1165T	possibly damaging	Het
Fer1l4	T	C	2: 156,051,993	R103G	probably benign	Het
G6pd2	T	A	5: 61,809,225	D114E	probably benign	Het
Galnt10	A	G	11: 57,781,056	K391E	probably damaging	Het
Gpr150	C	A	13: 76,055,926	C300F	probably benign	Het
Hhipl2	A	G	1: 183,423,571	T151A	probably damaging	Het
Hmcn2	C	A	2: 31,457,807	L4822M	probably damaging	Het
Ifi207	T	A	1: 173,732,387	Q173L	unknown	Het
Inca1	T	C	11: 70,689,881	E86G	probably damaging	Het
Iqca	A	G	1: 90,144,945	L71P	probably benign	Het
Kank2	G	T	9: 21,795,393	Q110K	probably damaging	Het
Kif13b	A	T	14: 64,737,555	M407L	probably damaging	Het
Kif5a	A	C	10: 127,245,441	I208S	probably damaging	Het
Kmt2c	T	C	5: 25,284,471	K4490R	probably damaging	Het
Ltbp2	C	T	12: 84,789,101	R1352H	probably benign	Het
Macf1	T	C	4: 123,452,154	Q2061R	possibly damaging	Het
Marcks	A	G	10: 37,136,167	S291P	probably benign	Het
Mccc1	A	G	3: 35,985,082	V254A	possibly damaging	Het
Mdn1	C	T	4: 32,754,547	R4683W	probably damaging	Het
Mon2	A	G	10: 123,010,492		probably null	Het
Ndrg4	A	T	8: 95,706,793	H134L	probably damaging	Het
Nek7	C	A	1: 138,534,363		probably null	Het
Nlrc3	C	T	16: 3,953,995	S151N	probably damaging	Het
Nsl1	C	A	1: 191,070,113	A146E	probably benign	Het
Olfr1391	A	C	11: 49,327,933	N174T	probably damaging	Het
Olfr1477	T	A	19: 13,502,558	Y72N	probably damaging	Het
Olfr519	A	T	7: 108,894,085	F107L	probably benign	Het
Olfr655	A	G	7: 104,596,897	Y95H	probably benign	Het
Olfr800	A	T	10: 129,660,038	R77S	probably benign	Het
Pde4d	A	C	13: 109,740,442	S41R	probably damaging	Het
Phlpp1	T	A	1: 106,347,132	L875*	probably null	Het
Pkd1	T	A	17: 24,580,212	S2802T	possibly damaging	Het
Polr3b	A	G	10: 84,674,590	T500A	probably benign	Het
Ppp2r2c	T	C	5: 36,940,187	V239A	probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Scube2	T	C	7: 109,808,444	D763G	probably damaging	Het
Setd5	T	C	6: 113,119,435	V534A	probably benign	Het
Slc10a4	T	A	5: 73,012,030	C333S	probably benign	Het
Slc15a1	G	A	14: 121,484,871	A206V	probably damaging	Het
Snx14	A	G	9: 88,391,776	L654P	probably damaging	Het
Sowahc	G	A	10: 59,223,190	A383T	possibly damaging	Het
Taf1b	A	G	12: 24,500,449	D11G	possibly damaging	Het
Tap1	C	T	17: 34,193,305	Q164*	probably null	Het
Tbcel	T	A	9: 42,415,872	R430W	probably damaging	Het
Trappc11	A	T	8: 47,512,559		probably null	Het
Trim15	T	C	17: 36,862,840	I259V	probably damaging	Het
Trpt1	T	C	19: 6,998,300	S141P	probably damaging	Het
Tsc2	T	A	17: 24,613,216	Q732L	probably benign	Het
Tstd3	C	A	4: 21,759,622		probably null	Het
Unc13d	T	C	11: 116,064,625	K914R	possibly damaging	Het
Unk	A	G	11: 116,049,331	E170G	probably damaging	Het
Uqcc2	T	A	17: 27,125,886	K62*	probably null	Het
Vim	A	G	2: 13,580,190	D394G	probably damaging	Het
Wdr47	G	A	3: 108,624,736		probably null	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTCCCTTGCTTAGTGGAC -3'
(R):5'- TGCCTAAGAGTAGCTCAAACC -3'

Sequencing Primer
(F):5'- AAGTTCATGATCAGATCTGGGC -3'
(R):5'- CTAAGAGTAGCTCAAACCAGAAATTG -3'

Posted On

2016-12-20