Incidental Mutation 'R5838:Arhgef12'
ID449731
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43005608 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 414 (T414I)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: T413I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: T413I

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: T414I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: T414I

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCAAGAATTATCCTTTGGATCCTC -3'
(R):5'- TTACCTGATTGAGCAGCCAC -3'

Sequencing Primer
(F):5'- TTTCATTCCCCAATCTAATCATGTAC -3'
(R):5'- TGATTGAGCAGCCACATACTG -3'
Posted On2016-12-20