Incidental Mutation 'R5838:Olfr1391'
ID449743
Institutional Source Beutler Lab
Gene Symbol Olfr1391
Ensembl Gene ENSMUSG00000101874
Gene Nameolfactory receptor 1391
SynonymsGA_x6K02T2QP88-6107233-6106298, MOR256-27
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49322742-49329810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49327933 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 174 (N174T)
Ref Sequence ENSEMBL: ENSMUSP00000150635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187509] [ENSMUST00000215671]
Predicted Effect probably damaging
Transcript: ENSMUST00000187509
AA Change: N174T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140343
Gene: ENSMUSG00000101874
AA Change: N174T

DomainStartEndE-ValueType
Pfam:7tm_1 41 289 2.2e-29 PFAM
Pfam:7tm_4 139 282 6.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215671
AA Change: N174T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Olfr1391
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Olfr1391 APN 11 49328131 missense probably damaging 1.00
IGL02171:Olfr1391 APN 11 49328035 missense possibly damaging 0.69
IGL03184:Olfr1391 APN 11 49327741 missense probably damaging 0.97
R0471:Olfr1391 UTSW 11 49327917 missense probably damaging 1.00
R0613:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R0616:Olfr1391 UTSW 11 49327756 missense probably damaging 1.00
R0825:Olfr1391 UTSW 11 49327682 missense probably benign 0.00
R1613:Olfr1391 UTSW 11 49327693 missense probably damaging 1.00
R3429:Olfr1391 UTSW 11 49328041 missense probably benign 0.00
R3727:Olfr1391 UTSW 11 49327795 missense probably benign 0.01
R4256:Olfr1391 UTSW 11 49327477 missense probably benign 0.20
R4459:Olfr1391 UTSW 11 49327876 missense probably damaging 1.00
R4552:Olfr1391 UTSW 11 49327950 missense probably benign 0.00
R4811:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R4881:Olfr1391 UTSW 11 49328297 missense probably benign 0.43
R6804:Olfr1391 UTSW 11 49327981 missense probably benign 0.16
R6809:Olfr1391 UTSW 11 49327860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTCAGTGTCCTTGCC -3'
(R):5'- CGACCAGATGTTGACTTGACCTTC -3'

Sequencing Primer
(F):5'- CTCTACAGAGAGTATGCTTCTAGTG -3'
(R):5'- TTCAGTACAGCCCTGGCAATG -3'
Posted On2016-12-20