Incidental Mutation 'R5838:Ace'
ID449747
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 1
SynonymsCD143
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105967945-105989964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105972880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 385 (V385I)
Ref Sequence ENSEMBL: ENSMUSP00000001963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
Predicted Effect probably benign
Transcript: ENSMUST00000001963
AA Change: V385I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: V385I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001964
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130673
Predicted Effect unknown
Transcript: ENSMUST00000132280
AA Change: V151I
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: V151I

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 intron probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R2074:Ace UTSW 11 105976623 nonsense probably null
R3025:Ace UTSW 11 105974093 splice site probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6106:Ace UTSW 11 105989012 missense probably damaging 1.00
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
R7471:Ace UTSW 11 105973482 missense probably damaging 1.00
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATTAGCTCAGTATCCCTGCCG -3'
(R):5'- AGGCCGATTTTGTGCAGATG -3'

Sequencing Primer
(F):5'- ACGACCAGCTGTGTTGC -3'
(R):5'- CAGATGTGCAGGGGTAGAGAC -3'
Posted On2016-12-20