Incidental Mutation 'R5838:Unc13d'
ID449749
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Nameunc-13 homolog D (C. elegans)
Synonyms2610108D09Rik, Munc13-4, Jinx
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5838 (G1)
Quality Score117
Status Not validated
Chromosome11
Chromosomal Location116062095-116077961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116064625 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 914 (K914R)
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000106452] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably benign
Transcript: ENSMUST00000021116
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075036
AA Change: K914R

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948
AA Change: K914R

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106450
AA Change: K916R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948
AA Change: K916R

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106451
AA Change: K916R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948
AA Change: K916R

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106452
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173943
Predicted Effect possibly damaging
Transcript: ENSMUST00000174822
AA Change: K914R

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948
AA Change: K914R

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 116074403 missense probably damaging 0.99
IGL00976:Unc13d APN 11 116070467 missense probably damaging 1.00
IGL01630:Unc13d APN 11 116073866 missense probably benign 0.00
IGL01761:Unc13d APN 11 116073869 missense probably damaging 1.00
IGL01772:Unc13d APN 11 116076532 missense possibly damaging 0.91
IGL01935:Unc13d APN 11 116069751 missense probably benign
IGL02486:Unc13d APN 11 116069806 splice site probably benign
IGL02503:Unc13d APN 11 116068802 missense possibly damaging 0.82
IGL02519:Unc13d APN 11 116070533 missense probably damaging 1.00
IGL02524:Unc13d APN 11 116070319 missense probably damaging 1.00
IGL02634:Unc13d APN 11 116070556 splice site probably benign
IGL02636:Unc13d APN 11 116073618 missense probably damaging 1.00
IGL03243:Unc13d APN 11 116067844 missense probably benign 0.34
jinx UTSW 11 116073423 unclassified probably benign
R0033:Unc13d UTSW 11 116069165 missense probably benign 0.00
R0084:Unc13d UTSW 11 116063831 missense probably damaging 1.00
R0122:Unc13d UTSW 11 116065482 missense probably benign 0.00
R0422:Unc13d UTSW 11 116070020 critical splice donor site probably null
R0666:Unc13d UTSW 11 116069492 splice site probably benign
R1019:Unc13d UTSW 11 116068074 missense probably benign 0.03
R1333:Unc13d UTSW 11 116073555 splice site probably benign
R1484:Unc13d UTSW 11 116073875 missense possibly damaging 0.72
R1594:Unc13d UTSW 11 116068712 missense probably benign 0.04
R1597:Unc13d UTSW 11 116074436 missense probably benign 0.02
R1603:Unc13d UTSW 11 116073655 missense possibly damaging 0.86
R1662:Unc13d UTSW 11 116068673 missense probably null 1.00
R1909:Unc13d UTSW 11 116070295 missense probably damaging 0.99
R2015:Unc13d UTSW 11 116068755 missense probably damaging 1.00
R2313:Unc13d UTSW 11 116063734 missense probably damaging 1.00
R2435:Unc13d UTSW 11 116068688 missense probably damaging 1.00
R4705:Unc13d UTSW 11 116073388 missense possibly damaging 0.70
R4732:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4733:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4792:Unc13d UTSW 11 116070282 missense probably damaging 1.00
R4843:Unc13d UTSW 11 116074259 missense probably damaging 1.00
R5496:Unc13d UTSW 11 116066708 missense probably damaging 1.00
R5571:Unc13d UTSW 11 116063654 missense probably benign 0.00
R5589:Unc13d UTSW 11 116069753 missense probably damaging 0.99
R6058:Unc13d UTSW 11 116073568 critical splice donor site probably null
R6266:Unc13d UTSW 11 116068238 missense probably damaging 1.00
R6807:Unc13d UTSW 11 116066751 missense probably damaging 0.98
R7085:Unc13d UTSW 11 116064807 missense probably benign 0.07
R7098:Unc13d UTSW 11 116063726 missense probably damaging 1.00
R7269:Unc13d UTSW 11 116068230 missense probably benign 0.01
R7291:Unc13d UTSW 11 116074050 missense possibly damaging 0.79
X0027:Unc13d UTSW 11 116069756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTCTCCTGATAACTGG -3'
(R):5'- CATTCCAGGCTCTGCAGAAC -3'

Sequencing Primer
(F):5'- GCTCTCTCCTGATAACTGGAAGAG -3'
(R):5'- AGGCTCTGCAGAACGACCTG -3'
Posted On2016-12-20