Incidental Mutation 'R5839:Clk1'
ID449771
Institutional Source Beutler Lab
Gene Symbol Clk1
Ensembl Gene ENSMUSG00000026034
Gene NameCDC-like kinase 1
SynonymsClk1, STY
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58410189-58424066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58421915 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 7 (T7I)
Ref Sequence ENSEMBL: ENSMUSP00000137815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034868] [ENSMUST00000148330] [ENSMUST00000151338]
Predicted Effect probably benign
Transcript: ENSMUST00000034868
AA Change: T7I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034868
Gene: ENSMUSG00000026034
AA Change: T7I

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 139 N/A INTRINSIC
S_TKc 160 476 3.55e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147258
Predicted Effect probably benign
Transcript: ENSMUST00000148330
AA Change: T7I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137649
Gene: ENSMUSG00000026034
AA Change: T7I

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151338
AA Change: T7I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137815
Gene: ENSMUSG00000026034
AA Change: T7I

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186552
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CDC2-like (or LAMMER) family of dual specificity protein kinases. In the nucleus, the encoded protein phosphorylates serine/arginine-rich proteins involved in pre-mRNA processing, releasing them into the nucleoplasm. The choice of splice sites during pre-mRNA processing may be regulated by the concentration of transacting factors, including serine/arginine rich proteins. Therefore, the encoded protein may play an indirect role in governing splice site selection. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Clk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Clk1 APN 1 58413452 missense possibly damaging 0.93
IGL01516:Clk1 APN 1 58414404 missense probably damaging 1.00
IGL01684:Clk1 APN 1 58417265 critical splice donor site probably null
IGL02621:Clk1 APN 1 58414455 missense probably damaging 1.00
IGL02812:Clk1 APN 1 58414476 missense probably damaging 0.98
IGL03028:Clk1 APN 1 58421102 nonsense probably null
IGL03117:Clk1 APN 1 58417007 splice site probably null
PIT4243001:Clk1 UTSW 1 58419677 missense probably damaging 1.00
R0149:Clk1 UTSW 1 58414601 missense probably damaging 1.00
R0309:Clk1 UTSW 1 58413033 splice site probably benign
R0730:Clk1 UTSW 1 58414399 missense probably benign 0.38
R1570:Clk1 UTSW 1 58414425 missense probably benign 0.28
R1729:Clk1 UTSW 1 58421261 missense probably damaging 1.00
R1905:Clk1 UTSW 1 58421942 splice site probably benign
R2382:Clk1 UTSW 1 58421289 missense probably benign 0.01
R2850:Clk1 UTSW 1 58412279 missense probably damaging 1.00
R4658:Clk1 UTSW 1 58412987 missense probably benign 0.01
R4846:Clk1 UTSW 1 58421102 missense probably benign 0.33
R5011:Clk1 UTSW 1 58414483 missense probably benign
R5196:Clk1 UTSW 1 58414613 missense probably benign 0.00
R5699:Clk1 UTSW 1 58420195 missense probably damaging 1.00
R5838:Clk1 UTSW 1 58412660 missense probably damaging 1.00
R6697:Clk1 UTSW 1 58414622 missense probably benign 0.21
R7293:Clk1 UTSW 1 58414613 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTACTTTATATGCCTTGTAAAGA -3'
(R):5'- GCAGACAGTTGACTAAAATTTTAGAAC -3'

Sequencing Primer
(F):5'- TTGGGAGCCAAACTGTCCTCTG -3'
(R):5'- GGCTCTTTGAATTCAAGGGCAAC -3'
Posted On2016-12-20