Incidental Mutation 'R5839:Cfap74'
ID449789
Institutional Source Beutler Lab
Gene Symbol Cfap74
Ensembl Gene ENSMUSG00000078490
Gene Namecilia and flagella associated protein 74
Synonyms2010015L04Rik
MMRRC Submission 044059-MU
Accession Numbers

NCBI RefSeq: isoform 1: NM_177674.5; isoform 2: NM_001166029.1; MGI: 1917130

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155409190-155466823 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 155422750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123952] [ENSMUST00000151083]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094408
SMART Domains Protein: ENSMUSP00000091975
Gene: ENSMUSG00000042233

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123952
SMART Domains Protein: ENSMUSP00000131899
Gene: ENSMUSG00000078490

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145520
Predicted Effect probably null
Transcript: ENSMUST00000151083
SMART Domains Protein: ENSMUSP00000123626
Gene: ENSMUSG00000078490

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166921
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Cfap74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Cfap74 APN 4 155418986 missense possibly damaging 0.95
paranoid UTSW 4 155454024 utr 5 prime probably benign
sensibile UTSW 4 155441286 missense probably null 0.03
touchy UTSW 4 155463072 missense probably benign 0.27
FR4304:Cfap74 UTSW 4 155415760 missense possibly damaging 0.93
P0007:Cfap74 UTSW 4 155422228 missense possibly damaging 0.83
PIT4434001:Cfap74 UTSW 4 155463964 missense unknown
R0025:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0034:Cfap74 UTSW 4 155460887 splice site probably benign
R0193:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0306:Cfap74 UTSW 4 155465439 unclassified probably benign
R0427:Cfap74 UTSW 4 155441277 missense probably benign 0.02
R0905:Cfap74 UTSW 4 155418696 critical splice donor site probably null
R1116:Cfap74 UTSW 4 155433996 missense probably benign 0.15
R1548:Cfap74 UTSW 4 155434045 missense probably benign 0.45
R1950:Cfap74 UTSW 4 155427430 critical splice donor site probably null
R2009:Cfap74 UTSW 4 155420267 missense possibly damaging 0.77
R2029:Cfap74 UTSW 4 155442081 missense possibly damaging 0.74
R2135:Cfap74 UTSW 4 155429940 missense probably damaging 0.97
R2135:Cfap74 UTSW 4 155429951 missense probably damaging 1.00
R2154:Cfap74 UTSW 4 155429296 missense possibly damaging 0.94
R2413:Cfap74 UTSW 4 155418624 missense possibly damaging 0.76
R2418:Cfap74 UTSW 4 155455709 utr 5 prime probably benign
R2930:Cfap74 UTSW 4 155438170 missense probably damaging 0.97
R3965:Cfap74 UTSW 4 155446717 missense probably damaging 1.00
R4078:Cfap74 UTSW 4 155455671 missense probably damaging 0.98
R4238:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4239:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4240:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4491:Cfap74 UTSW 4 155429171 missense probably benign 0.22
R4731:Cfap74 UTSW 4 155463602 intron probably benign
R5333:Cfap74 UTSW 4 155436740 missense probably damaging 0.99
R5362:Cfap74 UTSW 4 155438166 missense probably damaging 0.98
R5425:Cfap74 UTSW 4 155455692 utr 5 prime probably benign
R5468:Cfap74 UTSW 4 155426041 missense probably benign 0.27
R6010:Cfap74 UTSW 4 155454038 missense possibly damaging 0.83
R6284:Cfap74 UTSW 4 155451796 missense probably damaging 0.96
R6323:Cfap74 UTSW 4 155463938 missense possibly damaging 0.54
R6389:Cfap74 UTSW 4 155423336 missense possibly damaging 0.69
R6513:Cfap74 UTSW 4 155441286 missense probably null 0.03
R6527:Cfap74 UTSW 4 155422265 unclassified probably null
R6785:Cfap74 UTSW 4 155454024 utr 5 prime probably benign
R6980:Cfap74 UTSW 4 155466352 unclassified probably benign
R7039:Cfap74 UTSW 4 155454108 critical splice donor site probably null
R7077:Cfap74 UTSW 4 155455677 missense unknown
R7116:Cfap74 UTSW 4 155455061 missense unknown
R7227:Cfap74 UTSW 4 155460948 nonsense probably null
R7228:Cfap74 UTSW 4 155465050 missense unknown
R7261:Cfap74 UTSW 4 155465374 missense unknown
R7315:Cfap74 UTSW 4 155463019 missense unknown
T0970:Cfap74 UTSW 4 155463117 splice site probably null
X0066:Cfap74 UTSW 4 155463964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATTTTCACAAGGAATGCCATG -3'
(R):5'- CAGATGTGTGATGGAGCCAG -3'

Sequencing Primer
(F):5'- CCATGTGGCACATTGAGATCCAG -3'
(R):5'- TGTGTGATGGAGCCAGAGAAC -3'
Posted On2016-12-20