Incidental Mutation 'R5839:Slc8a2'
ID449801
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 2
SynonymsNcx2
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16129826-16161063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16134487 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 215 (I215F)
Ref Sequence ENSEMBL: ENSMUSP00000147497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably damaging
Transcript: ENSMUST00000168693
AA Change: I215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: I215F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211649
AA Change: I215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 16158893 missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 16157156 missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 16145029 missense possibly damaging 0.91
PIT4402001:Slc8a2 UTSW 7 16134494 missense probably damaging 1.00
PIT4515001:Slc8a2 UTSW 7 16140579 missense possibly damaging 0.69
R0281:Slc8a2 UTSW 7 16140989 missense probably benign
R0513:Slc8a2 UTSW 7 16157339 missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 16144962 missense probably benign 0.04
R1167:Slc8a2 UTSW 7 16157387 missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 16140597 missense probably benign 0.00
R1655:Slc8a2 UTSW 7 16141135 missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R1919:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R2051:Slc8a2 UTSW 7 16141015 missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 16134515 missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 16140492 splice site probably null
R2149:Slc8a2 UTSW 7 16159164 missense probably damaging 1.00
R3437:Slc8a2 UTSW 7 16158885 missense probably damaging 1.00
R3618:Slc8a2 UTSW 7 16152899 missense possibly damaging 0.48
R4645:Slc8a2 UTSW 7 16134239 missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 16134308 missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 16134175 nonsense probably null
R5071:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 16145176 missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 16157303 missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 16145284 missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 16145334 missense possibly damaging 0.94
R6363:Slc8a2 UTSW 7 16134045 missense probably benign 0.00
R6881:Slc8a2 UTSW 7 16157357 missense probably damaging 1.00
R7084:Slc8a2 UTSW 7 16145038 missense probably benign 0.17
R7211:Slc8a2 UTSW 7 16140613 missense possibly damaging 0.87
R7227:Slc8a2 UTSW 7 16144981 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCTGTGGCCACAACTTCCAG -3'
(R):5'- GAGCTCTATCTGTACCTGCAGTC -3'

Sequencing Primer
(F):5'- ACAACTTCCAGGCCGGTGAG -3'
(R):5'- GTACCTGCAGTCTTGACTTGCTG -3'
Posted On2016-12-20