Incidental Mutation 'R5839:Cysltr2'
ID449822
Institutional Source Beutler Lab
Gene Symbol Cysltr2
Ensembl Gene ENSMUSG00000033470
Gene Namecysteinyl leukotriene receptor 2
SynonymsCYSLT2R, 2300001H05Rik, Cyslt2, CysLT2
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73025603-73049114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73030183 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 29 (Y29C)
Ref Sequence ENSEMBL: ENSMUSP00000125958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044664] [ENSMUST00000169168]
Predicted Effect probably damaging
Transcript: ENSMUST00000044664
AA Change: Y29C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040715
Gene: ENSMUSG00000033470
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.6e-8 PFAM
Pfam:7tm_1 39 289 2.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169168
AA Change: Y29C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125958
Gene: ENSMUSG00000033470
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.4e-8 PFAM
Pfam:7tm_1 39 289 1.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228154
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR1. This encoded receptor is a member of the superfamily of G protein-coupled receptors. It seems to play a major role in endocrine and cardiovascular systems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced bleomycin-induced pulmonary fibrosis and reduced IgE dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Cysltr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Cysltr2 APN 14 73029715 missense possibly damaging 0.90
R1223:Cysltr2 UTSW 14 73030099 missense probably damaging 1.00
R1689:Cysltr2 UTSW 14 73030030 missense possibly damaging 0.75
R1695:Cysltr2 UTSW 14 73029881 missense probably benign 0.01
R1898:Cysltr2 UTSW 14 73029533 missense probably damaging 1.00
R3968:Cysltr2 UTSW 14 73030174 missense probably damaging 0.99
R4013:Cysltr2 UTSW 14 73029565 missense probably damaging 1.00
R4357:Cysltr2 UTSW 14 73029644 missense probably benign 0.15
R4444:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R4445:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R5207:Cysltr2 UTSW 14 73029511 missense probably damaging 0.99
R5591:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5592:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5593:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5885:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5886:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5934:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029949 missense probably damaging 1.00
X0009:Cysltr2 UTSW 14 73029979 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGACTCTGCAGGCCAAGTC -3'
(R):5'- GAGTACGGCAAATGTTTGATCAG -3'

Sequencing Primer
(F):5'- GCCAAGTCCCCAAATATCCAATTGG -3'
(R):5'- CGGCAAATGTTTGATCAGTAATCAGG -3'
Posted On2016-12-20