Mutagenetix > Incidental Mutations

Incidental Mutation 'R5820:4932438A13Rik'

449842

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.833) question?

Stock #

R5820 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37039526 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 875 (V875A)

Ref Sequence

ENSEMBL: ENSMUSP00000118092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

Predicted Effect

probably benign
Transcript: ENSMUST00000057272
AA Change: V4373A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: V4373A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136746

Predicted Effect

probably benign
Transcript: ENSMUST00000138950
AA Change: V875A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: V875A

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000141740
AA Change: V953A

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: V953A

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000146948
AA Change: V1078A

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: V1078A

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148698

Predicted Effect

probably benign
Transcript: ENSMUST00000152564
AA Change: V4373A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: V4373A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196036

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200245

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	G	14: 118,604,195	Y596H	probably benign	Het
Adgrg3	A	T	8: 95,039,593	M351L	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef38	A	T	3: 133,160,799	D192E	probably benign	Het
Arhgef40	T	C	14: 51,987,496	F33L	possibly damaging	Het
Arid1b	A	G	17: 4,996,254	Y439C	possibly damaging	Het
Bop1	G	A	15: 76,454,841	P386S	probably damaging	Het
Cacna1s	A	G	1: 136,079,604	H453R	probably damaging	Het
Canx	A	G	11: 50,308,383	V153A	probably damaging	Het
Chfr	T	A	5: 110,162,739	D475E	possibly damaging	Het
Clcn7	A	C	17: 25,149,052	K208T	probably damaging	Het
Cmya5	G	T	13: 93,092,780	N1933K	probably benign	Het
CN725425	A	G	15: 91,260,697	T588A	possibly damaging	Het
Cwh43	G	A	5: 73,428,632	W358*	probably null	Het
Cyfip2	A	T	11: 46,200,704	W1130R	probably damaging	Het
Ddx60	A	T	8: 61,956,121	D397V	possibly damaging	Het
Disp1	T	C	1: 183,135,587	S92G	probably benign	Het
Dusp6	A	G	10: 99,264,002	D104G	possibly damaging	Het
Dzank1	C	T	2: 144,513,488	V96M	probably damaging	Het
Ecscr	C	A	18: 35,717,267	V52F	possibly damaging	Het
Epha7	A	T	4: 28,949,365	N712I	probably damaging	Het
Eva1a	C	T	6: 82,071,173	P11S	probably benign	Het
Fam187b	T	C	7: 30,977,152	C29R	probably damaging	Het
Fau	T	C	19: 6,059,422	V117A	probably benign	Het
Fbxw11	A	G	11: 32,735,374	D369G	probably damaging	Het
Fkbp15	A	G	4: 62,345,546	F95L	probably benign	Het
Fkbp6	A	T	5: 135,339,920		probably null	Het
Fmo9	T	C	1: 166,664,601	K367E	possibly damaging	Het
Gad2	T	C	2: 22,690,249	V554A	probably benign	Het
Gm18025	T	C	12: 34,290,632	D154G	probably benign	Het
Gm4353	A	G	7: 116,084,458	F34S	possibly damaging	Het
Gucy2e	A	G	11: 69,232,696	I459T	probably benign	Het
Hpx	A	G	7: 105,591,788	I426T	possibly damaging	Het
Hspa9	T	C	18: 34,943,174	T362A	possibly damaging	Het
Insr	G	A	8: 3,155,976	P1271L	probably damaging	Het
Jarid2	G	A	13: 44,902,301	V328I	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif18b	A	G	11: 102,913,048	S429P	probably benign	Het
Lats1	A	T	10: 7,705,908	H819L	probably damaging	Het
Lmnb1	T	A	18: 56,740,786	D421E	possibly damaging	Het
Lrp4	T	C	2: 91,492,615	I1148T	probably damaging	Het
Map1b	T	A	13: 99,432,824	M1130L	unknown	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Myh6	T	C	14: 54,958,680	Y554C	probably damaging	Het
Myl4	T	C	11: 104,583,980	F52L	probably damaging	Het
Nol12	C	T	15: 78,940,480	T169I	probably benign	Het
Nrde2	C	T	12: 100,132,287	R707H	probably benign	Het
Oasl1	G	A	5: 114,936,978	V366M	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,599	I289T	possibly damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polrmt	C	T	10: 79,738,323		probably null	Het
Ppil4	A	G	10: 7,810,410	D344G	probably null	Het
Ppp2r3d	C	T	9: 124,422,765	A69T	possibly damaging	Het
Prmt3	C	T	7: 49,848,806	P487S	probably damaging	Het
Ptprm	A	T	17: 66,689,465	L1209H	probably damaging	Het
Rnf115	G	A	3: 96,727,848		probably benign	Het
Sec63	A	G	10: 42,796,245	D185G	possibly damaging	Het
Sema4b	T	C	7: 80,224,958	S699P	probably damaging	Het
Serpinb3d	T	G	1: 107,078,359	E333A	probably damaging	Het
Sh3rf2	T	C	18: 42,141,047	L426P	possibly damaging	Het
Slco6d1	A	G	1: 98,499,778	I611M	probably damaging	Het
Stk31	T	A	6: 49,417,285	Y194N	probably damaging	Het
Tlr9	G	A	9: 106,222,707		probably null	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Vmn1r188	G	A	13: 22,088,086	G70D	possibly damaging	Het
Zfp318	A	G	17: 46,412,773	M1901V	probably benign	Het
Zfp407	A	T	18: 84,560,524	D821E	probably benign	Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37011727	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36987299	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37052547	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37030751	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37039462	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37041345	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37000041	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37006984	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37046280	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37005013	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36947755	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36973452	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36942292	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37048121	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37003759	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36887770	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36996308	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36973260	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36942382	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37008485	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36974311	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36992673	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37034736	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37041363	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36928520	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36957016	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37004873	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36906735	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36969290	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36921437	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37030664	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37048113	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36958868	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36895315	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37044608	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37035945	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37041484	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36967305	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36946494	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36958757	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36965677	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36969207	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36969208	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37038517	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37034602	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36948066	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37050934	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36949996	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36906683	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37002635	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37047991	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36870077	missense	possibly damaging	0.90
FR4340:4932438A13Rik	UTSW	3	37050752	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37050754	critical splice acceptor site	probably benign
R0035:4932438A13Rik	UTSW	3	36987598	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37028159	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36917773	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36906788	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36969152	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37046252	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36989804	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37000065	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36987635	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37036825	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36996458	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36987690	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37044626	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36928463	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36946364	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36959334	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	36983453	missense	possibly damaging	0.69
R1056:4932438A13Rik	UTSW	3	37044680	missense	probably benign	0.44
R1080:4932438A13Rik	UTSW	3	36988255	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36996523	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36987045	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37044631	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36895303	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36996312	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36948375	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36946470	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36952184	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36987210	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1364:4932438A13Rik	UTSW	3	36987030	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36942429	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36965586	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37008434	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1533:4932438A13Rik	UTSW	3	37041375	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36870056	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36942399	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37035812	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36959432	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36908231	nonsense	probably null
R1919:4932438A13Rik	UTSW	3	37006983	critical splice acceptor site	probably null
R1983:4932438A13Rik	UTSW	3	36887865	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36953985	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37000032	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36908211	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36895378	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36928551	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37047961	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37003878	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36947853	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36953970	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36875530	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36885396	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36958685	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36947953	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37007122	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36958805	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36875462	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37011703	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36959415	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37041912	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37030565	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37040434	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36885398	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37030061	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37012575	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37030589	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36931083	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36920236	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36988147	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36958681	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37040395	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36895311	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37030025	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36889990	makesense	probably null
R4705:4932438A13Rik	UTSW	3	37041889	missense	probably benign	0.03
R4735:4932438A13Rik	UTSW	3	37004967	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36942375	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37022466	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36937065	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36964968	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36965937	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36998199	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36987165	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36917702	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36919901	missense	probably benign	0.41
R4980:4932438A13Rik	UTSW	3	36943312	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36943399	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37040506	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37041390	missense	probably damaging	1.00
R5089:4932438A13Rik	UTSW	3	36987502	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37000085	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37034757	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37033265	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37048050	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37000109	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37048146	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36917668	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36875516	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36917677	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36917660	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36921360	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36958714	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36992733	unclassified	probably null
R5800:4932438A13Rik	UTSW	3	37052443	missense	probably damaging	1.00
R5819:4932438A13Rik	UTSW	3	37048600	missense	probably benign	0.12
R5952:4932438A13Rik	UTSW	3	36965621	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36969221	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36931116	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36988169	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36948304	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36983471	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36956999	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36931111	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36908228	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37033307	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37008443	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36988085	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37011566	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36874282	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37021481	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36967189	missense	probably damaging	1.00
X0050:4932438A13Rik	UTSW	3	36957128	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36987567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATTCCATTGAAGGAGTGAGC -3'
(R):5'- TTACTAGACAGCCACAGAGCTC -3'

Sequencing Primer
(F):5'- AAGGAGTGAGCCAGCACCTTTC -3'
(R):5'- CAGAGCTCTTCTGTAGGTAGTACC -3'

Posted On

2016-12-20