Incidental Mutation 'R5820:Cwh43'
ID449849
Institutional Source Beutler Lab
Gene Symbol Cwh43
Ensembl Gene ENSMUSG00000029154
Gene Namecell wall biogenesis 43 C-terminal homolog
SynonymsC130090K23Rik
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5820 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73406075-73453435 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 73428632 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 358 (W358*)
Ref Sequence ENSEMBL: ENSMUSP00000069563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031040] [ENSMUST00000065543]
Predicted Effect probably null
Transcript: ENSMUST00000031040
AA Change: W444*
SMART Domains Protein: ENSMUSP00000031040
Gene: ENSMUSG00000029154
AA Change: W444*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 351 368 N/A INTRINSIC
transmembrane domain 395 412 N/A INTRINSIC
Pfam:Exo_endo_phos 435 580 5.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065543
AA Change: W358*
SMART Domains Protein: ENSMUSP00000069563
Gene: ENSMUSG00000029154
AA Change: W358*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
transmembrane domain 309 326 N/A INTRINSIC
Pfam:Exo_endo_phos 345 494 4.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135820
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arhgef40 T C 14: 51,987,496 F33L possibly damaging Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Chfr T A 5: 110,162,739 D475E possibly damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Gucy2e A G 11: 69,232,696 I459T probably benign Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myh6 T C 14: 54,958,680 Y554C probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Cwh43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Cwh43 APN 5 73421489 missense possibly damaging 0.93
IGL02225:Cwh43 APN 5 73421567 missense probably damaging 1.00
R0115:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0423:Cwh43 UTSW 5 73416742 missense probably benign 0.00
R0481:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0786:Cwh43 UTSW 5 73408183 nonsense probably null
R1635:Cwh43 UTSW 5 73434310 missense probably damaging 1.00
R1729:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1784:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1927:Cwh43 UTSW 5 73453074 missense probably benign 0.27
R2070:Cwh43 UTSW 5 73421517 missense probably damaging 1.00
R2104:Cwh43 UTSW 5 73421530 missense possibly damaging 0.93
R2136:Cwh43 UTSW 5 73415054 missense probably benign 0.01
R2517:Cwh43 UTSW 5 73421543 missense probably benign 0.04
R2964:Cwh43 UTSW 5 73408336 splice site probably benign
R3713:Cwh43 UTSW 5 73438492 missense probably damaging 0.99
R4291:Cwh43 UTSW 5 73411932 missense probably benign 0.35
R4333:Cwh43 UTSW 5 73441379 missense probably damaging 0.99
R4869:Cwh43 UTSW 5 73428673 critical splice donor site probably null
R5071:Cwh43 UTSW 5 73423913 critical splice acceptor site probably null
R5309:Cwh43 UTSW 5 73416767 missense probably benign
R5451:Cwh43 UTSW 5 73431913 missense probably benign 0.14
R5471:Cwh43 UTSW 5 73408231 nonsense probably null
R5601:Cwh43 UTSW 5 73417940 splice site probably null
R5652:Cwh43 UTSW 5 73418141 missense probably damaging 0.99
R5823:Cwh43 UTSW 5 73411870 missense probably benign 0.27
R6351:Cwh43 UTSW 5 73411905 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGCTTTGAGAAGACCATAGGG -3'
(R):5'- CACAAGGTGACGCTTCCTTAGG -3'

Sequencing Primer
(F):5'- CTATGGGATTTTCTTTGCTGAAATG -3'
(R):5'- GGTGACGCTTCCTTAGGAACTTAAC -3'
Posted On2016-12-20