Incidental Mutation 'R5820:Canx'
ID449880
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R5820 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50308383 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 153 (V153A)
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]
Predicted Effect probably damaging
Transcript: ENSMUST00000020637
AA Change: V153A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: V153A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179865
AA Change: V153A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: V153A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arhgef40 T C 14: 51,987,496 F33L possibly damaging Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Chfr T A 5: 110,162,739 D475E possibly damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cwh43 G A 5: 73,428,632 W358* probably null Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Gucy2e A G 11: 69,232,696 I459T probably benign Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myh6 T C 14: 54,958,680 Y554C probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCAGCAGCATTTCTTTTC -3'
(R):5'- GCAAACAAATGTCTGGCTTTTGC -3'

Sequencing Primer
(F):5'- CAGCAGCAGCATTTCTTTTCATAGG -3'
(R):5'- TTTTTGATTTTTGTGTGGCCGAG -3'
Posted On2016-12-20