Incidental Mutation 'R5820:Arhgef40'
ID449891
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5820 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51987496 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 33 (F33L)
Ref Sequence ENSEMBL: ENSMUSP00000138125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093813
AA Change: F33L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100639
AA Change: F33L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect possibly damaging
Transcript: ENSMUST00000182061
AA Change: F33L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182193
AA Change: F33L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect silent
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182609
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect possibly damaging
Transcript: ENSMUST00000182760
AA Change: F33L

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
AA Change: F33L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000182909
AA Change: F33L

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect possibly damaging
Transcript: ENSMUST00000183208
AA Change: F33L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562
AA Change: F33L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Chfr T A 5: 110,162,739 D475E possibly damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cwh43 G A 5: 73,428,632 W358* probably null Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Gucy2e A G 11: 69,232,696 I459T probably benign Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myh6 T C 14: 54,958,680 Y554C probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTATCTGCAAACTGGCCAAC -3'
(R):5'- ACAATCATGGGAGGTCAGGC -3'

Sequencing Primer
(F):5'- CTCCCAAGGAGCCATGCTTAG -3'
(R):5'- TGAGACCTAAAGGCTCCTGG -3'
Posted On2016-12-20