Incidental Mutation 'R5821:Pomgnt1'
ID449927
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Nameprotein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms0610016I07Rik, 4930467B06Rik
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116123840-116159849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116155736 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 407 (S407G)
Ref Sequence ENSEMBL: ENSMUSP00000112911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]
Predicted Effect probably benign
Transcript: ENSMUST00000106494
AA Change: S385G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700
AA Change: S385G

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
PDB:2YOQ|C 106 195 6e-10 PDB
Pfam:GNT-I 271 591 3e-52 PFAM
low complexity region 623 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106496
AA Change: S374G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700
AA Change: S374G

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOP|C 129 217 5e-10 PDB
Pfam:GNT-I 260 580 2.9e-52 PFAM
low complexity region 612 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106498
AA Change: S407G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700
AA Change: S407G

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120083
AA Change: S407G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700
AA Change: S407G

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121052
AA Change: S407G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700
AA Change: S407G

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155718
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116152761 missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116152908 nonsense probably null
IGL02582:Pomgnt1 APN 4 116158550 missense probably damaging 1.00
pomegranate UTSW 4 116154890 missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116158560 critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116155889 missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116152185 missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116151851 missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116155275 splice site probably null
R1983:Pomgnt1 UTSW 4 116151869 missense probably damaging 1.00
R1983:Pomgnt1 UTSW 4 116151920 missense probably benign 0.12
R2034:Pomgnt1 UTSW 4 116157927 missense possibly damaging 0.87
R3721:Pomgnt1 UTSW 4 116153543 splice site probably benign
R3774:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3775:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116152923 missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116158494 missense probably benign 0.03
R4616:Pomgnt1 UTSW 4 116154890 missense probably damaging 1.00
R4690:Pomgnt1 UTSW 4 116155510 missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116154215 missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116155775 missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116156199 missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116156256 intron probably benign
R5569:Pomgnt1 UTSW 4 116155967 missense probably damaging 1.00
R5937:Pomgnt1 UTSW 4 116153913 missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116151602 missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116153883 missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116154154 missense probably damaging 0.97
T0722:Pomgnt1 UTSW 4 116137427 unclassified probably benign
T0975:Pomgnt1 UTSW 4 116137427 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCACAATTGAAGGATGTGC -3'
(R):5'- TCCACACGGTACAGTAGTGC -3'

Sequencing Primer
(F):5'- CCTTGGAGAGCTTTGAATGAGC -3'
(R):5'- CAGTAGTGCTGGATCCTCAG -3'
Posted On2016-12-20