Incidental Mutation 'R5822:4930553M12Rik'
ID449969
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene NameRIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88867882-88868379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88868359 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 7 (I7M)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: I7M
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88868073 nonsense probably null
R0194:4930553M12Rik UTSW 4 88868243 missense unknown
R2143:4930553M12Rik UTSW 4 88868174 missense unknown
R2143:4930553M12Rik UTSW 4 88868175 missense unknown
R2144:4930553M12Rik UTSW 4 88868174 missense unknown
R2144:4930553M12Rik UTSW 4 88868175 missense unknown
R5135:4930553M12Rik UTSW 4 88868271 missense unknown
R5848:4930553M12Rik UTSW 4 88868359 missense unknown
R5849:4930553M12Rik UTSW 4 88868359 missense unknown
R5850:4930553M12Rik UTSW 4 88868359 missense unknown
R5854:4930553M12Rik UTSW 4 88868359 missense unknown
R5856:4930553M12Rik UTSW 4 88868359 missense unknown
R6128:4930553M12Rik UTSW 4 88868359 missense unknown
R6130:4930553M12Rik UTSW 4 88868359 missense unknown
R7054:4930553M12Rik UTSW 4 88868249 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTCTCGCCCAAAGAATC -3'
(R):5'- ACAAAGAATATTCTGGCACTGGG -3'

Sequencing Primer
(F):5'- AAAGAATCCGCTTATTCCCCTG -3'
(R):5'- CCTTTTGGAGCCAGCCAAC -3'
Posted On2016-12-20