Incidental Mutation 'R5822:Tnnt1'
ID449973
Institutional Source Beutler Lab
Gene Symbol Tnnt1
Ensembl Gene ENSMUSG00000064179
Gene Nametroponin T1, skeletal, slow
SynonymsssTnT, sTnT, Tnt, skeletal muscle slow-twitch TnT
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4504570-4516382 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4516346 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 12 (L12*)
Ref Sequence ENSEMBL: ENSMUSP00000129409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000098859] [ENSMUST00000108587] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000163538] [ENSMUST00000163560] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163] [ENSMUST00000209148]
Predicted Effect probably benign
Transcript: ENSMUST00000071798
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098859
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108587
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132621
Predicted Effect probably benign
Transcript: ENSMUST00000140424
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150166
Predicted Effect probably benign
Transcript: ENSMUST00000154913
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163538
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163560
Predicted Effect probably benign
Transcript: ENSMUST00000163710
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163722
AA Change: L12*
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179
AA Change: L12*

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166161
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166268
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166959
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178163
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209148
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a null or hypomorphic allele show small and loss of type I slow skeletal muscle fibers with compensatory hypertrophy of type II fast fibers and reduced contractile force and tolerance of skeletal muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Tnnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Tnnt1 APN 7 4507550 missense possibly damaging 0.96
IGL01391:Tnnt1 APN 7 4514212 critical splice donor site probably null
IGL01582:Tnnt1 APN 7 4509983 missense probably damaging 1.00
R0098:Tnnt1 UTSW 7 4509045 missense probably damaging 0.99
R0963:Tnnt1 UTSW 7 4507595 missense probably damaging 1.00
R1489:Tnnt1 UTSW 7 4507525 nonsense probably null
R2340:Tnnt1 UTSW 7 4513616 splice site probably benign
R4224:Tnnt1 UTSW 7 4510007 missense probably damaging 1.00
R4624:Tnnt1 UTSW 7 4512268 intron probably benign
R4969:Tnnt1 UTSW 7 4507574 missense probably damaging 1.00
R5245:Tnnt1 UTSW 7 4510067 missense probably damaging 1.00
R6520:Tnnt1 UTSW 7 4509061 nonsense probably null
R6556:Tnnt1 UTSW 7 4509577 missense probably damaging 1.00
R6573:Tnnt1 UTSW 7 4514334 splice site probably null
R6838:Tnnt1 UTSW 7 4507407 missense possibly damaging 0.94
X0010:Tnnt1 UTSW 7 4509971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACACCTGTCATCGGCTTC -3'
(R):5'- GTTGTCACCACGGTGGAATTC -3'

Sequencing Primer
(F):5'- GGCTTCAACATCCCTGTAGG -3'
(R):5'- CACCACGGTGGAATTCTGGTG -3'
Posted On2016-12-20