Incidental Mutation 'R5822:Ggn'
ID449976
Institutional Source Beutler Lab
Gene Symbol Ggn
Ensembl Gene ENSMUSG00000031493
Gene Namegametogenetin
Synonyms
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29170210-29173976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29172556 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 454 (P454S)
Ref Sequence ENSEMBL: ENSMUSP00000146750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209019] [ENSMUST00000209034]
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098609
AA Change: P490S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: P490S

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207087
Predicted Effect probably benign
Transcript: ENSMUST00000208288
Predicted Effect probably damaging
Transcript: ENSMUST00000208330
AA Change: P467S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208659
Predicted Effect probably damaging
Transcript: ENSMUST00000209019
AA Change: P454S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Ggn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0302:Ggn UTSW 7 29171240 unclassified probably null
R0317:Ggn UTSW 7 29171090 start codon destroyed probably null
R0376:Ggn UTSW 7 29173022 missense possibly damaging 0.51
R0469:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0581:Ggn UTSW 7 29172304 missense probably benign 0.40
R1375:Ggn UTSW 7 29171941 missense probably damaging 0.97
R1956:Ggn UTSW 7 29171916 missense probably damaging 0.99
R2012:Ggn UTSW 7 29173763 unclassified probably null
R4436:Ggn UTSW 7 29171551 missense probably damaging 0.98
R4444:Ggn UTSW 7 29172160 missense probably benign 0.06
R4977:Ggn UTSW 7 29172196 missense probably damaging 1.00
R5762:Ggn UTSW 7 29172352 missense probably damaging 0.98
R6180:Ggn UTSW 7 29173049 missense probably damaging 0.98
R6294:Ggn UTSW 7 29173848 missense possibly damaging 0.92
R6667:Ggn UTSW 7 29172668 missense possibly damaging 0.71
R6963:Ggn UTSW 7 29171582 missense probably damaging 0.99
R7084:Ggn UTSW 7 29172998 missense probably damaging 0.97
R7242:Ggn UTSW 7 29173034 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCGATTCAATGGGGCTGTC -3'
(R):5'- GCTGGAACTTGGGATGTGAC -3'

Sequencing Primer
(F):5'- TCTCAGGGCCTTGGGGATC -3'
(R):5'- AGTTGCAGCTGGGACCTG -3'
Posted On2016-12-20