Incidental Mutation 'R5822:Olfr160'
List |< first << previous [record 34 of 52] next >> last >|
ID449981
Institutional Source Beutler Lab
Gene Symbol Olfr160
Ensembl Gene ENSMUSG00000061165
Gene Nameolfactory receptor 160
SynonymsGA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, MOR171-3
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37708964-37716250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37711791 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 163 (M163V)
Ref Sequence ENSEMBL: ENSMUSP00000151178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104875] [ENSMUST00000211952] [ENSMUST00000215727]
Predicted Effect probably benign
Transcript: ENSMUST00000104875
AA Change: M163V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000100468
Gene: ENSMUSG00000061165
AA Change: M163V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.5e-48 PFAM
Pfam:7tm_1 41 290 6.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211952
AA Change: M163V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000215727
AA Change: M163V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele respond heterogeneously to odorants and display abnormal innervation of glomeruli by olfactory sensory axons in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Olfr160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Olfr160 APN 9 37711836 missense probably damaging 0.98
IGL02195:Olfr160 APN 9 37712121 missense probably benign
R0099:Olfr160 UTSW 9 37711454 missense probably damaging 0.99
R0124:Olfr160 UTSW 9 37711463 missense possibly damaging 0.79
R0129:Olfr160 UTSW 9 37711940 missense probably damaging 1.00
R0882:Olfr160 UTSW 9 37711872 missense probably benign 0.02
R1855:Olfr160 UTSW 9 37711970 missense possibly damaging 0.92
R1988:Olfr160 UTSW 9 37711697 missense possibly damaging 0.50
R2346:Olfr160 UTSW 9 37711365 missense possibly damaging 0.50
R4164:Olfr160 UTSW 9 37711698 missense probably benign 0.03
R4274:Olfr160 UTSW 9 37712068 missense probably damaging 1.00
R4504:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4505:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4506:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R5017:Olfr160 UTSW 9 37711525 nonsense probably null
R5268:Olfr160 UTSW 9 37712004 missense probably damaging 1.00
R5316:Olfr160 UTSW 9 37711685 missense possibly damaging 0.90
R5372:Olfr160 UTSW 9 37711938 missense possibly damaging 0.49
R5385:Olfr160 UTSW 9 37712021 missense probably damaging 1.00
R5906:Olfr160 UTSW 9 37711805 missense probably benign 0.23
R5990:Olfr160 UTSW 9 37712110 missense probably damaging 0.99
R6842:Olfr160 UTSW 9 37711589 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTGGAGCTGATGCGAAGG -3'
(R):5'- GGTGCATGTCTCAGCTATACTTC -3'

Sequencing Primer
(F):5'- CTGATGCGAAGGATGCTGGAC -3'
(R):5'- CTTCCTGGTTTTCGTCATTGCTGAG -3'
Posted On2016-12-20