Incidental Mutation 'R5822:Fyb'
ID449996
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 6663226 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461]
Predicted Effect probably benign
Transcript: ENSMUST00000090461
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162154
Predicted Effect probably benign
Transcript: ENSMUST00000163073
SMART Domains Protein: ENSMUSP00000123895
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:hSH3 86 170 4.1e-42 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 unclassified probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTTGAAACACTTAAGGTATGTTGT -3'
(R):5'- ACAGTAAGAAACCCTTGATCACA -3'

Sequencing Primer
(F):5'- GAACGACACTAGAGGTTGTCTTCC -3'
(R):5'- GTAAGAAACCCTTGATCACAACAAC -3'
Posted On2016-12-20