Incidental Mutation 'R5822:Rims2'
ID449998
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39476490 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 860 (L860Q)
Ref Sequence ENSEMBL: ENSMUSP00000154153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect probably damaging
Transcript: ENSMUST00000042917
AA Change: L860Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: L860Q

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082054
AA Change: L900Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: L900Q

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227243
AA Change: L860Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000227381
AA Change: L580Q
Meta Mutation Damage Score 0.524 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGGGAATATAAACCTTACTTGAC -3'
(R):5'- ACACTCATCTTTGCTAAGGATCTC -3'

Sequencing Primer
(F):5'- ATAAACCTTACTTGACTTTTTCCCTG -3'
(R):5'- CCACTCAGTTTTATCTTTAAGCAGTG -3'
Posted On2016-12-20