Incidental Mutation 'R5822:Cyp11b1'
ID449999
Institutional Source Beutler Lab
Gene Symbol Cyp11b1
Ensembl Gene ENSMUSG00000075604
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 1
SynonymsCyp11b-1, Cyp11b
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R5822 (G1)
Quality Score170
Status Validated
Chromosome15
Chromosomal Location74834125-74841643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74836821 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 375 (R375G)
Ref Sequence ENSEMBL: ENSMUSP00000127888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170259] [ENSMUST00000188180]
Predicted Effect probably null
Transcript: ENSMUST00000170259
AA Change: R375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127888
Gene: ENSMUSG00000075604
AA Change: R375G

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 497 4.3e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Meta Mutation Damage Score 0.6468 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit adrenal hypertrophy, abnormal organ weights, abnormal hormone levels, abnormal urine chemistry, hypokalemia, increased blood pressure, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Cyp11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Cyp11b1 APN 15 74835853 unclassified probably null
IGL01154:Cyp11b1 APN 15 74838534 missense probably benign
IGL01982:Cyp11b1 APN 15 74839403 missense possibly damaging 0.69
IGL02156:Cyp11b1 APN 15 74835797 missense probably benign 0.25
IGL02424:Cyp11b1 APN 15 74839236 missense probably benign 0.23
IGL02937:Cyp11b1 APN 15 74836559 missense possibly damaging 0.81
IGL03080:Cyp11b1 APN 15 74839436 splice site probably null
IGL03101:Cyp11b1 APN 15 74835854 missense probably benign 0.39
R1230:Cyp11b1 UTSW 15 74840942 missense probably benign 0.01
R1699:Cyp11b1 UTSW 15 74840817 missense possibly damaging 0.89
R1755:Cyp11b1 UTSW 15 74838534 missense probably benign
R2913:Cyp11b1 UTSW 15 74836421 missense probably damaging 0.99
R4361:Cyp11b1 UTSW 15 74839016 missense possibly damaging 0.87
R4459:Cyp11b1 UTSW 15 74836359 missense probably damaging 0.98
R6921:Cyp11b1 UTSW 15 74840949 missense probably benign 0.00
R7214:Cyp11b1 UTSW 15 74836859 missense probably benign 0.00
X0064:Cyp11b1 UTSW 15 74841587 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAAGGCTTCTCCTGTCCACATC -3'
(R):5'- CAATGTCCTTTGGCAGGGTG -3'

Sequencing Primer
(F):5'- TCCTGTCCACATCCACACC -3'
(R):5'- GAGATTGCTCTCTGGCTCCTG -3'
Posted On2016-12-20