Incidental Mutation 'R5822:Chkb'
List |< first << previous [record 8 of 52] next >> last >|
ID450001
Institutional Source Beutler Lab
Gene Symbol Chkb
Ensembl Gene ENSMUSG00000022617
Gene Namecholine kinase beta
SynonymsChetk, Chkl, CK/EK-beta
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5822 (G1)
Quality Score203
Status Validated
Chromosome15
Chromosomal Location89426360-89429908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89429512 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 30 (E30G)
Ref Sequence ENSEMBL: ENSMUSP00000154958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000168646] [ENSMUST00000170460] [ENSMUST00000171666]
Predicted Effect probably benign
Transcript: ENSMUST00000023289
AA Change: E30G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617
AA Change: E30G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:APH 70 317 1.9e-14 PFAM
Pfam:Choline_kinase 97 308 1.5e-76 PFAM
low complexity region 324 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052315
AA Change: E30G

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000109313
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166267
Predicted Effect probably benign
Transcript: ENSMUST00000168376
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170334
Predicted Effect probably benign
Transcript: ENSMUST00000170460
SMART Domains Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 176 1e-65 PFAM
Pfam:APH 8 176 6.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171140
Predicted Effect probably benign
Transcript: ENSMUST00000171666
SMART Domains Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 142 2.5e-51 PFAM
Pfam:APH 1 149 6.9e-14 PFAM
Pfam:EcKinase 2 116 8.8e-8 PFAM
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice display progressive muscular weakness and dystrophy in the hindlimbs but have normal nerve and neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Chkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Chkb APN 15 89427591 missense probably benign 0.05
IGL00922:Chkb APN 15 89422288 critical splice donor site probably null
IGL00943:Chkb APN 15 89428748 missense probably damaging 1.00
IGL01415:Chkb APN 15 89428784 missense probably damaging 1.00
IGL01537:Chkb APN 15 89427783 splice site probably benign
IGL01710:Chkb APN 15 89426640 nonsense probably null
IGL01720:Chkb APN 15 89427952 splice site probably null
IGL02725:Chkb APN 15 89429137 missense probably damaging 1.00
R0402:Chkb UTSW 15 89429407 missense probably benign 0.01
R1779:Chkb UTSW 15 89429057 missense possibly damaging 0.76
R2001:Chkb UTSW 15 89428766 missense probably damaging 1.00
R4999:Chkb UTSW 15 89428165 missense probably damaging 1.00
R5452:Chkb UTSW 15 89429585 unclassified probably benign
R6820:Chkb UTSW 15 89428176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATCCACACAGGTCAG -3'
(R):5'- GAATCGCATCTGGCTTGGAAAC -3'

Sequencing Primer
(F):5'- GATCCACACAGGTCAGGCTCAG -3'
(R):5'- AGAGACTCTGCGGCTTCC -3'
Posted On2016-12-20