Incidental Mutation 'R5822:Ddx11'
ID450006
Institutional Source Beutler Lab
Gene Symbol Ddx11
Ensembl Gene ENSMUSG00000035842
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
SynonymsCHL1, 4732462I11Rik, CHLR1, essa15a, KRG2
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66123520-66152174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66129981 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 90 (S90L)
Ref Sequence ENSEMBL: ENSMUSP00000153635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903] [ENSMUST00000225956]
Predicted Effect probably benign
Transcript: ENSMUST00000163605
AA Change: S90L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842
AA Change: S90L

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223600
Predicted Effect probably benign
Transcript: ENSMUST00000224497
AA Change: S90L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000224903
AA Change: S90L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225687
Predicted Effect probably benign
Transcript: ENSMUST00000225956
AA Change: S90L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before E11.5 with growth retardation, failure of chorioallantoic fusion, poor placental labyrinth development, and embryonic cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Ddx11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ddx11 APN 17 66134137 missense probably damaging 1.00
IGL01577:Ddx11 APN 17 66139403 missense possibly damaging 0.95
IGL02558:Ddx11 APN 17 66148672 missense probably damaging 0.99
IGL02801:Ddx11 APN 17 66148033 missense probably benign 0.03
R1550:Ddx11 UTSW 17 66138220 missense probably benign 0.16
R1587:Ddx11 UTSW 17 66149256 missense probably damaging 1.00
R1601:Ddx11 UTSW 17 66150385 missense probably damaging 1.00
R1625:Ddx11 UTSW 17 66150697 missense probably benign 0.45
R1714:Ddx11 UTSW 17 66148759 missense probably damaging 1.00
R1867:Ddx11 UTSW 17 66135939 intron probably null
R1959:Ddx11 UTSW 17 66130728 missense probably benign 0.27
R1980:Ddx11 UTSW 17 66148739 missense probably damaging 0.97
R2392:Ddx11 UTSW 17 66149973 missense probably damaging 1.00
R3118:Ddx11 UTSW 17 66149277 missense probably damaging 1.00
R3425:Ddx11 UTSW 17 66139439 missense possibly damaging 0.62
R3983:Ddx11 UTSW 17 66134130 missense probably damaging 1.00
R4571:Ddx11 UTSW 17 66130773 missense probably benign 0.20
R4576:Ddx11 UTSW 17 66150726 missense probably damaging 1.00
R4847:Ddx11 UTSW 17 66130801 missense probably damaging 1.00
R5010:Ddx11 UTSW 17 66147722 missense possibly damaging 0.60
R5414:Ddx11 UTSW 17 66148768 missense probably benign 0.40
R5610:Ddx11 UTSW 17 66150026 missense probably damaging 1.00
R5972:Ddx11 UTSW 17 66148090 missense probably benign 0.05
R6017:Ddx11 UTSW 17 66130017 missense probably benign 0.02
R6267:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R6296:Ddx11 UTSW 17 66150729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTTGCTTCTGGCCTG -3'
(R):5'- ATTGCAAGTTCACCCAAGGG -3'

Sequencing Primer
(F):5'- CTTCTGGCCTGGTTTGAGGTC -3'
(R):5'- CAAGTTCACCCAAGGGCTGAG -3'
Posted On2016-12-20