Incidental Mutation 'R5823:Phf3'
ID450008
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30804683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1732 (I1732V)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: I1732V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: I1732V

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: I1732V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: I1732V

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190190
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGTCCTGGAAATGGGAATC -3'
(R):5'- ACCTGAAAAGGGACCCTAGG -3'

Sequencing Primer
(F):5'- AGGACTGGACTTGAGGTGC -3'
(R):5'- TGGAGACAAGCATGCTGC -3'
Posted On2016-12-20