Incidental Mutation 'R5824:Ap4b1'
ID450061
Institutional Source Beutler Lab
Gene Symbol Ap4b1
Ensembl Gene ENSMUSG00000032952
Gene Nameadaptor-related protein complex AP-4, beta 1
SynonymsAP-4 beta-4, 1810038H16Rik
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103809520-103822025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103813385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 124 (I124F)
Ref Sequence ENSEMBL: ENSMUSP00000143463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably benign
Transcript: ENSMUST00000029435
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000047285
AA Change: I199F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952
AA Change: I199F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076599
AA Change: I199F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952
AA Change: I199F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106823
AA Change: I199F

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952
AA Change: I199F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
AA Change: I124F

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952
AA Change: I124F

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect probably benign
Transcript: ENSMUST00000199686
Predicted Effect probably benign
Transcript: ENSMUST00000199710
AA Change: I124F

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053
AA Change: I124F

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199723
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit poor rotarod performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Ap4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ap4b1 APN 3 103821542 missense probably benign 0.19
IGL01545:Ap4b1 APN 3 103812827 missense probably benign 0.02
IGL02422:Ap4b1 APN 3 103812854 missense possibly damaging 0.95
IGL02525:Ap4b1 APN 3 103812848 missense probably damaging 1.00
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0086:Ap4b1 UTSW 3 103814860 missense probably damaging 0.99
R0090:Ap4b1 UTSW 3 103820429 missense possibly damaging 0.91
R0136:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0299:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0403:Ap4b1 UTSW 3 103818839 missense probably damaging 0.99
R0403:Ap4b1 UTSW 3 103821396 missense probably benign 0.00
R1283:Ap4b1 UTSW 3 103818861 missense probably damaging 1.00
R1673:Ap4b1 UTSW 3 103817845 critical splice donor site probably null
R1797:Ap4b1 UTSW 3 103818833 missense possibly damaging 0.92
R1869:Ap4b1 UTSW 3 103820868 nonsense probably null
R2925:Ap4b1 UTSW 3 103820681 missense probably damaging 1.00
R3905:Ap4b1 UTSW 3 103818893 missense possibly damaging 0.94
R4079:Ap4b1 UTSW 3 103813378 missense probably damaging 1.00
R4645:Ap4b1 UTSW 3 103821449 missense probably benign 0.32
R4786:Ap4b1 UTSW 3 103818804 missense probably benign 0.00
R6342:Ap4b1 UTSW 3 103813368 missense possibly damaging 0.60
R6826:Ap4b1 UTSW 3 103812908 critical splice donor site probably null
R6923:Ap4b1 UTSW 3 103812214 missense probably benign 0.19
R6974:Ap4b1 UTSW 3 103813285 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGTCTGGCCAGAGCTGTTAC -3'
(R):5'- TCCACAGCATGTTCCTACTG -3'

Sequencing Primer
(F):5'- AGAGCTGTTACTCTGGTTCTGTCAC -3'
(R):5'- CATACACAGTAATAAAGGAAGGC -3'
Posted On2016-12-20