Incidental Mutation 'R5824:Arhgap10'
ID450069
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene NameRho GTPase activating protein 10
SynonymsPSGAP-m, A930033B01Rik, PSGAP-s
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location77250366-77517953 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 77358552 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 462 (Y462*)
Ref Sequence ENSEMBL: ENSMUSP00000147485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
Predicted Effect probably null
Transcript: ENSMUST00000076316
AA Change: Y462*
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: Y462*

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210519
AA Change: Y440*
Predicted Effect probably null
Transcript: ENSMUST00000210922
AA Change: Y462*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 77346291 missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 77411134 splice site probably benign
IGL01802:Arhgap10 APN 8 77420085 missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77259129 missense probably benign 0.00
IGL02291:Arhgap10 APN 8 77382715 splice site probably benign
IGL02834:Arhgap10 APN 8 77365100 missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77250910 unclassified probably benign
IGL03149:Arhgap10 APN 8 77409538 splice site probably benign
IGL03215:Arhgap10 APN 8 77277152 missense probably benign
IGL03331:Arhgap10 APN 8 77420082 missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 77413581 missense probably benign 0.11
R0376:Arhgap10 UTSW 8 77450824 splice site probably benign
R0454:Arhgap10 UTSW 8 77250965 missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 77351687 splice site probably benign
R1033:Arhgap10 UTSW 8 77257347 missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 77310769 missense probably damaging 0.98
R1083:Arhgap10 UTSW 8 77517749 missense probably damaging 1.00
R1596:Arhgap10 UTSW 8 77450697 missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 77358587 nonsense probably null
R1918:Arhgap10 UTSW 8 77259079 missense probably benign
R1937:Arhgap10 UTSW 8 77344653 missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 77409626 missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 77450926 splice site probably benign
R3703:Arhgap10 UTSW 8 77259056 critical splice donor site probably null
R3979:Arhgap10 UTSW 8 77420725 missense probably benign 0.01
R4854:Arhgap10 UTSW 8 77420089 nonsense probably null
R4855:Arhgap10 UTSW 8 77432738 critical splice donor site probably null
R4928:Arhgap10 UTSW 8 77426328 critical splice donor site probably null
R5033:Arhgap10 UTSW 8 77382757 missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 77420072 missense probably benign 0.19
R5644:Arhgap10 UTSW 8 77411055 missense probably benign 0.00
R5781:Arhgap10 UTSW 8 77450707 missense possibly damaging 0.56
R5861:Arhgap10 UTSW 8 77310764 missense probably damaging 1.00
R5872:Arhgap10 UTSW 8 77344638 critical splice donor site probably null
R6360:Arhgap10 UTSW 8 77259202 nonsense probably null
R6423:Arhgap10 UTSW 8 77517757 missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 77411063 missense probably benign 0.00
R6900:Arhgap10 UTSW 8 77310862 missense probably damaging 1.00
R6936:Arhgap10 UTSW 8 77310747 nonsense probably null
R7001:Arhgap10 UTSW 8 77365088 missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77250954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTACTTAACAGTGGTGCT -3'
(R):5'- TGCTGTCATTAAAAGATTGCATACA -3'

Sequencing Primer
(F):5'- GTGATTCTGTAAGCAAGCCCC -3'
(R):5'- CTTGCTGTTCACCAGATGT -3'
Posted On2016-12-20