Incidental Mutation 'R5824:Agtpbp1'
ID450079
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 043216-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59466099 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 66 (H66Q)
Ref Sequence ENSEMBL: ENSMUSP00000153569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]
Predicted Effect probably damaging
Transcript: ENSMUST00000022040
AA Change: H1009Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: H1009Q

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163149
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164215
AA Change: H1009Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: H1009Q

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000170555
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224397
AA Change: H66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225133
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCATGGACTAACATTTTGTATGGC -3'
(R):5'- GTGCGAAAACCCATAACTGC -3'

Sequencing Primer
(F):5'- GGCTTACATGCACTGCAAATTC -3'
(R):5'- TGCGAAAACCCATAACTGCTTACG -3'
Posted On2016-12-20