Incidental Mutation 'R5825:Olfr1126'
ID450106
Institutional Source Beutler Lab
Gene Symbol Olfr1126
Ensembl Gene ENSMUSG00000058194
Gene Nameolfactory receptor 1126
SynonymsGA_x6K02T2Q125-48959068-48960012, MOR264-5
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87453962-87458911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87457450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 95 (D95G)
Ref Sequence ENSEMBL: ENSMUSP00000150504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071355] [ENSMUST00000213366]
Predicted Effect probably benign
Transcript: ENSMUST00000071355
AA Change: D95G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071313
Gene: ENSMUSG00000058194
AA Change: D95G

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 8.6e-52 PFAM
Pfam:7tm_1 47 296 8.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213366
AA Change: D95G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Olfr1126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1126 APN 2 87457927 missense probably damaging 1.00
IGL01875:Olfr1126 APN 2 87457310 missense probably damaging 0.99
IGL02207:Olfr1126 APN 2 87457450 missense probably benign 0.22
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0478:Olfr1126 UTSW 2 87458026 missense probably damaging 0.99
R1055:Olfr1126 UTSW 2 87457437 small deletion probably benign
R1438:Olfr1126 UTSW 2 87457992 missense probably benign 0.00
R1625:Olfr1126 UTSW 2 87457672 missense probably damaging 1.00
R1912:Olfr1126 UTSW 2 87457383 missense probably damaging 1.00
R3052:Olfr1126 UTSW 2 87457903 missense probably damaging 1.00
R4638:Olfr1126 UTSW 2 87457983 missense possibly damaging 0.60
R5102:Olfr1126 UTSW 2 87457794 missense probably benign
R5526:Olfr1126 UTSW 2 87457765 missense probably benign 0.01
R5965:Olfr1126 UTSW 2 87458037 missense probably benign 0.14
R6505:Olfr1126 UTSW 2 87457927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGAGTTTCTCCTCCTGGG -3'
(R):5'- TGCCAGCTGAGTGCACTTTG -3'

Sequencing Primer
(F):5'- TGACCTTCCTAACTTACAAGGG -3'
(R):5'- GCACTTTGTTGGGTTCATGAC -3'
Posted On2016-12-20