Incidental Mutation 'R0549:Papss1'
ID45013
Institutional Source Beutler Lab
Gene Symbol Papss1
Ensembl Gene ENSMUSG00000028032
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 1
SynonymsAsapk, SK1
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R0549 (G1)
Quality Score200
Status Validated
Chromosome3
Chromosomal Location131564768-131643671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131619213 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 456 (E456G)
Ref Sequence ENSEMBL: ENSMUSP00000142616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029666] [ENSMUST00000197402] [ENSMUST00000199878] [ENSMUST00000200527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029666
AA Change: E477G

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029666
Gene: ENSMUSG00000028032
AA Change: E477G

DomainStartEndE-ValueType
Pfam:APS_kinase 51 209 5.6e-78 PFAM
Pfam:AAA_17 54 184 1.7e-7 PFAM
Pfam:AAA_33 55 182 4.4e-9 PFAM
Pfam:PUA_2 225 386 3.3e-51 PFAM
Pfam:ATP-sulfurylase 394 617 7.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197402
Predicted Effect possibly damaging
Transcript: ENSMUST00000199878
AA Change: E456G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142533
Gene: ENSMUSG00000028032
AA Change: E456G

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200527
AA Change: E456G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142616
Gene: ENSMUSG00000028032
AA Change: E456G

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Papss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Papss1 APN 3 131599949 missense probably benign 0.00
IGL01642:Papss1 APN 3 131583235 splice site probably benign
IGL02249:Papss1 APN 3 131602011 missense probably damaging 1.00
IGL02832:Papss1 APN 3 131582519 missense probably damaging 1.00
IGL03008:Papss1 APN 3 131585099 missense possibly damaging 0.55
IGL03180:Papss1 APN 3 131607382 missense probably damaging 1.00
IGL03343:Papss1 APN 3 131583189 missense probably benign 0.27
IGL03384:Papss1 APN 3 131579352 missense probably damaging 0.96
R0685:Papss1 UTSW 3 131583093 missense possibly damaging 0.61
R0800:Papss1 UTSW 3 131599854 splice site probably benign
R1225:Papss1 UTSW 3 131579301 splice site probably benign
R1458:Papss1 UTSW 3 131605854 missense probably damaging 1.00
R1718:Papss1 UTSW 3 131619185 missense probably damaging 1.00
R1728:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1784:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1862:Papss1 UTSW 3 131583184 missense possibly damaging 0.93
R1937:Papss1 UTSW 3 131599871 missense probably benign 0.38
R2349:Papss1 UTSW 3 131599866 missense probably benign
R3859:Papss1 UTSW 3 131607335 missense probably benign 0.30
R4698:Papss1 UTSW 3 131607331 missense probably damaging 0.97
R4741:Papss1 UTSW 3 131619099 missense probably damaging 1.00
R5333:Papss1 UTSW 3 131643044 missense probably damaging 1.00
R5642:Papss1 UTSW 3 131631804 nonsense probably null
R6658:Papss1 UTSW 3 131605935 missense probably benign
R6932:Papss1 UTSW 3 131599971 missense probably damaging 1.00
Z1088:Papss1 UTSW 3 131642967 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGGGTGGTGCTTGAAAGTCCTAAC -3'
(R):5'- ATCCAGGAACGGTCAGTAGGTCAG -3'

Sequencing Primer
(F):5'- TGCTTGAAAGTCCTAACTCTGG -3'
(R):5'- CAGTTGGTGATAATACAATGTTCCC -3'
Posted On2013-06-11