Incidental Mutation 'R5825:Igf2'
ID450131
Institutional Source Beutler Lab
Gene Symbol Igf2
Ensembl Gene ENSMUSG00000048583
Gene Nameinsulin-like growth factor 2
SynonymsM6pr, Mpr, Igf-2, Igf-II, Peg2
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142650766-142666816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142653855 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 168 (H168Q)
Ref Sequence ENSEMBL: ENSMUSP00000101556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000033] [ENSMUST00000097936] [ENSMUST00000105935] [ENSMUST00000105936] [ENSMUST00000121128] [ENSMUST00000145896] [ENSMUST00000178921] [ENSMUST00000228850]
Predicted Effect probably damaging
Transcript: ENSMUST00000000033
AA Change: H168Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000033
Gene: ENSMUSG00000048583
AA Change: H168Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093631
Predicted Effect probably damaging
Transcript: ENSMUST00000097936
AA Change: H168Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095549
Gene: ENSMUSG00000048583
AA Change: H168Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105935
AA Change: H168Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101555
Gene: ENSMUSG00000048583
AA Change: H168Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105936
AA Change: H168Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101556
Gene: ENSMUSG00000048583
AA Change: H168Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121128
AA Change: H179Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114076
Gene: ENSMUSG00000048583
AA Change: H179Q

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IlGF 41 95 2.09e-22 SMART
Pfam:IGF2_C 123 177 6.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143666
Predicted Effect probably benign
Transcript: ENSMUST00000145896
SMART Domains Protein: ENSMUSP00000122653
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163148
Predicted Effect probably benign
Transcript: ENSMUST00000178921
SMART Domains Protein: ENSMUSP00000136786
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
IlGF 67 121 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228850
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mutations that are paternally transmitted result in growth deficiency. Heterozygous mice inheriting a mutant allele from their mother appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Igf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Igf2 APN 7 142654048 missense probably benign 0.09
R2012:Igf2 UTSW 7 142654399 missense probably damaging 1.00
R4024:Igf2 UTSW 7 142654307 missense probably benign 0.23
R4275:Igf2 UTSW 7 142655786 missense probably benign 0.00
R5247:Igf2 UTSW 7 142653931 missense possibly damaging 0.90
R6185:Igf2 UTSW 7 142658381 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACTGCTGAGATCCCCTTGC -3'
(R):5'- GCAAGTTCTTCCAATATGACACCTG -3'

Sequencing Primer
(F):5'- TGAGATCCCCTTGCCCGATG -3'
(R):5'- GTTCTTCCAATATGACACCTGGAGAC -3'
Posted On2016-12-20