Incidental Mutation 'R5825:Nynrin'
ID450139
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55864226 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 451 (R451G)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably benign
Transcript: ENSMUST00000100529
AA Change: R451G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: R451G

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168479
AA Change: R451G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: R451G

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181218
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ATGAACTGCAGTCTCTTCACC -3'
(R):5'- AGAGAGAACGGCTTTTCCAG -3'

Sequencing Primer
(F):5'- AAATTTCCCCTTCTGGCAGAGG -3'
(R):5'- CAGGCCTTTACAATCTGACAGTG -3'
Posted On2016-12-20