Incidental Mutation 'R5825:Crebbp'
ID450143
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5825 (G1)
Quality Score193
Status Not validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4087742 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1705 (V1705A)
Ref Sequence ENSEMBL: ENSMUSP00000023165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765] [ENSMUST00000206098]
Predicted Effect probably damaging
Transcript: ENSMUST00000023165
AA Change: V1705A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: V1705A

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191387
Predicted Effect probably benign
Transcript: ENSMUST00000205344
Predicted Effect probably damaging
Transcript: ENSMUST00000205765
AA Change: V1667A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205945
Predicted Effect probably benign
Transcript: ENSMUST00000206098
Predicted Effect probably benign
Transcript: ENSMUST00000206464
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTACAAGGGTGCTACTCCTC -3'
(R):5'- TGGGCCTGTTATCAGCACTC -3'

Sequencing Primer
(F):5'- GTGCTACTCCTCATCCTGGGAG -3'
(R):5'- TAGCTGTGACCTCATGGA -3'
Posted On2016-12-20